53 lines
3.5 KiB
Text
53 lines
3.5 KiB
Text
|
|
Global alignment is designed to search for highly similar regions in two or more DNA sequences, where the
|
||
|
|
sequences appear in the same order and orientation, fitting the sequences in as pieces in a puzzle.
|
||
|
|
|
||
|
|
Current DNA sequencers find the sequence for multiple small segments of DNA which have mostly randomly formed by splitting a much larger DNA molecule into shorter segments. When re-assembling such segments of DNA sequences into a larger sequence to form, for example, the DNA coding for the relevant gene, the overlaps between multiple shorter sequences are commonly used to decide how the longer sequence is to be assembled. For example, "AAGATGGA", GGAGCGCATC", and "ATCGCAATAAGGA" can be assembled into the sequence "AAGATGGAGCGCATCGCAATAAGGA" by noting that "GGA" is at the tail of the first string and head of the second string and "ATC" likewise is at the tail
|
||
|
|
of the second and head of the third string.
|
||
|
|
|
||
|
|
When looking for the best global alignment in the output strings produced by DNA sequences, there are
|
||
|
|
typically a large number of such overlaps among a large number of sequences. In such a case, the ordering
|
||
|
|
that results in the shortest common superstring is generrally preferred.
|
||
|
|
|
||
|
|
Finding such a supersequence is an NP-hard problem, and many algorithms have been proposed to
|
||
|
|
shorten calculations, especially when many very long sequences are matched.
|
||
|
|
|
||
|
|
The shortest common superstring as used in bioinfomatics here differs from the string task
|
||
|
|
[[Shortest_common_supersequence]]. In that task, a supersequence
|
||
|
|
may have other characters interposed as long as the characters of each subsequence appear in order,
|
||
|
|
so that (abcbdab, abdcaba) -> abdcabdab. In this task, (abcbdab, abdcaba) -> abcbdabdcaba.
|
||
|
|
|
||
|
|
|
||
|
|
;Task:
|
||
|
|
:* Given N non-identical strings of characters A, C, G, and T representing N DNA sequences, find the shortest DNA sequence containing all N sequences.
|
||
|
|
|
||
|
|
:* Handle cases where two sequences are identical or one sequence is entirely contained in another.
|
||
|
|
|
||
|
|
:* Print the resulting sequence along with its size (its base count) and a count of each base in the sequence.
|
||
|
|
|
||
|
|
:* Find the shortest common superstring for the following four examples:
|
||
|
|
:
|
||
|
|
("TA", "AAG", "TA", "GAA", "TA")
|
||
|
|
|
||
|
|
("CATTAGGG", "ATTAG", "GGG", "TA")
|
||
|
|
|
||
|
|
("AAGAUGGA", "GGAGCGCAUC", "AUCGCAAUAAGGA")
|
||
|
|
|
||
|
|
("ATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTAT",
|
||
|
|
"GGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGT",
|
||
|
|
"CTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA",
|
||
|
|
"TGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC",
|
||
|
|
"AACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT",
|
||
|
|
"GCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTC",
|
||
|
|
"CGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCT",
|
||
|
|
"TGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC",
|
||
|
|
"CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGC",
|
||
|
|
"GATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATT",
|
||
|
|
"TTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC",
|
||
|
|
"CTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA",
|
||
|
|
"TCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGA")
|
||
|
|
|
||
|
|
;Related tasks:
|
||
|
|
:* [[Bioinformatics/base_count|Bioinformatics base count]].
|
||
|
|
:* [[Bioinformatics/Sequence_mutation|Bioinformatics sequence mutation]].
|
||
|
|
<br><br>
|