Initial data commit

This commit is contained in:
Ingy döt Net 2023-07-01 11:58:00 -04:00
parent 72d218235f
commit f23f22d71c
199087 changed files with 3378941 additions and 0 deletions

View file

@ -0,0 +1,2 @@
---
from: http://rosettacode.org/wiki/Bioinformatics/Sequence_mutation

View file

@ -0,0 +1,15 @@
;Task:
Given a string of characters A, C, G, and T representing a DNA sequence write a routine to mutate the sequence, (string) by:
# Choosing a random base position in the sequence.
# Mutate the sequence by doing one of either:
## '''S'''wap the base at that position by changing it to one of A, C, G, or T. (which has a chance of swapping the base for the same base)
## '''D'''elete the chosen base at the position.
## '''I'''nsert another base randomly chosen from A,C, G, or T into the sequence at that position.
# Randomly generate a test DNA sequence of at least 200 bases
# "Pretty print" the sequence and a count of its size, and the count of each base in the sequence
# Mutate the sequence ten times.
# "Pretty print" the sequence after all mutations, and a count of its size, and the count of each base in the sequence.
;Extra credit:
* Give more information on the individual mutations applied.
* Allow mutations to be weighted and/or chosen.

View file

@ -0,0 +1,51 @@
UInt32 seed = 0
F nonrandom(n)
:seed = 1664525 * :seed + 1013904223
R Int(:seed >> 16) % n
F nonrandom_choice(lst)
R lst[nonrandom(lst.len)]
F basecount(dna)
DefaultDict[Char, Int] d
L(c) dna
d[c]++
R sorted(d.items())
F seq_split(dna, n = 50)
R (0 .< dna.len).step(n).map(i -> @dna[i .< i + @n])
F seq_pp(dna, n = 50)
L(part) seq_split(dna, n)
print(#5: #..format(L.index * n, part))
print("\n BASECOUNT:")
V tot = 0
L(base, count) basecount(dna)
print( #3: #..format(base, count))
tot += count
V (base, count) = (TOT, tot)
print( #3= #..format(base, count))
F seq_mutate(String =dna; count = 1, kinds = IDSSSS, choice = ATCG)
[(String, Int)] mutation
V k2txt = [I = Insert, D = Delete, S = Substitute]
L 0 .< count
V kind = nonrandom_choice(kinds)
V index = nonrandom(dna.len + 1)
I kind == I
dna = dna[0 .< index]nonrandom_choice(choice)dna[index..]
E I kind == D & !dna.empty
dna = dna[0 .< index]dna[index+1..]
E I kind == S & !dna.empty
dna = dna[0 .< index]nonrandom_choice(choice)dna[index+1..]
mutation.append((k2txt[kind], index))
R (dna, mutation)
print(SEQUENCE:)
V sequence = TCAATCATTAATCGATTAATACATTCAATTTGAACATCTCCAGGAGAAGGCAGGGTAATCTCGTGTAGCCGTGCTTGGGGCCTCCGATATGGCCGGGGAATTTCAAAGTATAGTGTGCATCCCCTCATAATACATAGATCTATAGGTAAGTATATGGGTTGACGTTGTTAGATGCGATACACGTGCACACTTTATGAATTTTACGTTCCTCTGCCTAGAGTGCCAAGTTTCAATTTGCTACGGTTCCTCA
seq_pp(sequence)
print("\n\nMUTATIONS:")
V (mseq, m) = seq_mutate(sequence, 10)
L(kind, index) m
print( #10 @#..format(kind, index))
print()
seq_pp(mseq)

View file

@ -0,0 +1,117 @@
with Ada.Containers.Vectors;
with Ada.Numerics.Discrete_Random;
with Ada.Text_Io;
procedure Mutations is
Width : constant := 60;
type Nucleotide_Type is (A, C, G, T);
type Operation_Type is (Delete, Insert, Swap);
type Position_Type is new Natural;
package Position_Io is new Ada.Text_Io.Integer_Io (Position_Type);
package Nucleotide_Io is new Ada.Text_Io.Enumeration_Io (Nucleotide_Type);
package Operation_Io is new Ada.Text_Io.Enumeration_Io (Operation_Type);
use Ada.Text_Io, Position_Io, Nucleotide_Io, Operation_Io;
package Sequence_Vectors is new Ada.Containers.Vectors (Index_Type => Position_Type,
Element_Type => Nucleotide_Type);
package Nucleotide_Generators is new Ada.Numerics.Discrete_Random (Result_Subtype => Nucleotide_Type);
package Operation_Generators is new Ada.Numerics.Discrete_Random (Result_Subtype => Operation_Type);
procedure Pretty_Print (Sequence : Sequence_Vectors.Vector) is
First : Position_Type := Sequence.First_Index;
Last : Position_Type;
Count : array (Nucleotide_Type) of Natural := (others => 0);
begin
Last := Position_Type'Min (First + Width - 1,
Sequence.Last_Index);
loop
Position_Io.Put (First, Width => 4);
Put (": ");
for N in First .. Last loop
declare
Nucleotide : Nucleotide_Type renames Sequence (N);
begin
Put (Nucleotide);
Count (Nucleotide) := Count (Nucleotide) + 1;
end;
end loop;
New_Line;
exit when Last = Sequence.Last_Index;
First := Last + 1;
Last := Position_Type'Min (First + Width - 1,
Sequence.Last_Index);
end loop;
for N in Count'Range loop
Put ("Count of "); Put (N); Put (" is "); Put (Natural'Image (Count (N))); New_Line;
end loop;
end Pretty_Print;
function Random_Position (First, Last : Position_Type) return Position_Type is
subtype Position_Range is Position_Type range First .. Last;
package Position_Generators is new Ada.Numerics.Discrete_Random (Result_Subtype => Position_Range);
Generator : Position_Generators.Generator;
begin
Position_Generators.Reset (Generator);
return Position_Generators.Random (Generator);
end Random_Position;
Nucleotide_Generator : Nucleotide_Generators.Generator;
Operation_Generator : Operation_Generators.Generator;
Sequence : Sequence_Vectors.Vector;
Position : Position_Type;
Nucleotide : Nucleotide_Type;
Operation : Operation_Type;
begin
Nucleotide_Generators.Reset (Nucleotide_Generator);
Operation_Generators.Reset (Operation_Generator);
for A in 1 .. 200 loop
Sequence.Append (Nucleotide_Generators.Random (Nucleotide_Generator));
end loop;
Put_Line ("Initial sequence:");
Pretty_Print (Sequence);
New_Line;
Put_Line ("Mutations:");
for Mutate in 1 .. 10 loop
Operation := Operation_Generators.Random (Operation_Generator);
case Operation is
when Delete =>
Position := Random_Position (Sequence.First_Index, Sequence.Last_Index);
Sequence.Delete (Index => Position);
Put (Operation); Put (" at position "); Put (Position, Width => 0); New_Line;
when Insert =>
Position := Random_Position (Sequence.First_Index, Sequence.Last_Index + 1);
Nucleotide := Nucleotide_Generators.Random (Nucleotide_Generator);
Sequence.Insert (Before => Position,
New_Item => Nucleotide);
Put (Operation); Put (" "); Put (Nucleotide); Put (" at position ");
Put (Position, Width => 0); New_Line;
when Swap =>
Position := Random_Position (Sequence.First_Index, Sequence.Last_Index);
Nucleotide := Nucleotide_Generators.Random (Nucleotide_Generator);
Sequence.Replace_Element (Index => Position,
New_Item => Nucleotide);
Put (Operation); Put (" at position "); Put (Position, Width => 0);
Put (" to "); Put (Nucleotide); New_Line;
end case;
end loop;
New_Line;
Put_Line ("Mutated sequence:");
Pretty_Print (Sequence);
end Mutations;

View file

@ -0,0 +1,68 @@
bases: ["A" "T" "G" "C"]
dna: map 1..200 => [sample bases]
prettyPrint: function [in][
count: #[ A: 0, T: 0, G: 0, C: 0 ]
loop.with:'i split.every:50 in 'line [
prints [pad to :string i*50 3 ":"]
print map split.every:10 line => join
loop split line 'ch [
case [ch=]
when? -> "A" -> count\A: count\A + 1
when? -> "T" -> count\T: count\T + 1
when? -> "G" -> count\G: count\G + 1
when? -> "C" -> count\C: count\C + 1
else []
]
]
print ["Total count => A:" count\A, "T:" count\T "G:" count\G "C:" count\C]
]
performRandomModifications: function [seq,times][
result: new seq
loop times [x][
what: random 1 3
case [what=]
when? -> 1 [
ind: random 0 (size result)
previous: get result ind
next: sample bases
set result ind next
print ["changing base at position" ind "from" previous "to" next]
]
when? -> 2 [
ind: random 0 (size result)
next: sample bases
result: insert result ind next
print ["inserting base" next "at position" ind]
]
else [
ind: random 0 (size result)
previous: get result ind
result: remove result .index ind
print ["deleting base" previous "at position" ind]
]
]
return result
]
print "------------------------------"
print " Initial sequence"
print "------------------------------"
prettyPrint dna
print ""
print "------------------------------"
print " Modifying sequence"
print "------------------------------"
dna: performRandomModifications dna 10
print ""
print "------------------------------"
print " Final sequence"
print "------------------------------"
prettyPrint dna
print ""

View file

@ -0,0 +1,124 @@
#include <array>
#include <iomanip>
#include <iostream>
#include <random>
#include <string>
class sequence_generator {
public:
sequence_generator();
std::string generate_sequence(size_t length);
void mutate_sequence(std::string&);
static void print_sequence(std::ostream&, const std::string&);
enum class operation { change, erase, insert };
void set_weight(operation, unsigned int);
private:
char get_random_base() {
return bases_[base_dist_(engine_)];
}
operation get_random_operation();
static const std::array<char, 4> bases_;
std::mt19937 engine_;
std::uniform_int_distribution<size_t> base_dist_;
std::array<unsigned int, 3> operation_weight_;
unsigned int total_weight_;
};
const std::array<char, 4> sequence_generator::bases_{ 'A', 'C', 'G', 'T' };
sequence_generator::sequence_generator() : engine_(std::random_device()()),
base_dist_(0, bases_.size() - 1),
total_weight_(operation_weight_.size()) {
operation_weight_.fill(1);
}
sequence_generator::operation sequence_generator::get_random_operation() {
std::uniform_int_distribution<unsigned int> op_dist(0, total_weight_ - 1);
unsigned int n = op_dist(engine_), op = 0, weight = 0;
for (; op < operation_weight_.size(); ++op) {
weight += operation_weight_[op];
if (n < weight)
break;
}
return static_cast<operation>(op);
}
void sequence_generator::set_weight(operation op, unsigned int weight) {
total_weight_ -= operation_weight_[static_cast<size_t>(op)];
operation_weight_[static_cast<size_t>(op)] = weight;
total_weight_ += weight;
}
std::string sequence_generator::generate_sequence(size_t length) {
std::string sequence;
sequence.reserve(length);
for (size_t i = 0; i < length; ++i)
sequence += get_random_base();
return sequence;
}
void sequence_generator::mutate_sequence(std::string& sequence) {
std::uniform_int_distribution<size_t> dist(0, sequence.length() - 1);
size_t pos = dist(engine_);
char b;
switch (get_random_operation()) {
case operation::change:
b = get_random_base();
std::cout << "Change base at position " << pos << " from "
<< sequence[pos] << " to " << b << '\n';
sequence[pos] = b;
break;
case operation::erase:
std::cout << "Erase base " << sequence[pos] << " at position "
<< pos << '\n';
sequence.erase(pos, 1);
break;
case operation::insert:
b = get_random_base();
std::cout << "Insert base " << b << " at position "
<< pos << '\n';
sequence.insert(pos, 1, b);
break;
}
}
void sequence_generator::print_sequence(std::ostream& out, const std::string& sequence) {
constexpr size_t base_count = bases_.size();
std::array<size_t, base_count> count = { 0 };
for (size_t i = 0, n = sequence.length(); i < n; ++i) {
if (i % 50 == 0) {
if (i != 0)
out << '\n';
out << std::setw(3) << i << ": ";
}
out << sequence[i];
for (size_t j = 0; j < base_count; ++j) {
if (bases_[j] == sequence[i]) {
++count[j];
break;
}
}
}
out << '\n';
out << "Base counts:\n";
size_t total = 0;
for (size_t j = 0; j < base_count; ++j) {
total += count[j];
out << bases_[j] << ": " << count[j] << ", ";
}
out << "Total: " << total << '\n';
}
int main() {
sequence_generator gen;
gen.set_weight(sequence_generator::operation::change, 2);
std::string sequence = gen.generate_sequence(250);
std::cout << "Initial sequence:\n";
sequence_generator::print_sequence(std::cout, sequence);
constexpr int count = 10;
for (int i = 0; i < count; ++i)
gen.mutate_sequence(sequence);
std::cout << "After " << count << " mutations:\n";
sequence_generator::print_sequence(std::cout, sequence);
return 0;
}

View file

@ -0,0 +1,211 @@
#include<stdlib.h>
#include<stdio.h>
#include<time.h>
typedef struct genome{
char base;
struct genome *next;
}genome;
typedef struct{
char mutation;
int position;
}genomeChange;
typedef struct{
int adenineCount,thymineCount,cytosineCount,guanineCount;
}baseCounts;
genome *strand;
baseCounts baseData;
int genomeLength = 100, lineLength = 50;
int numDigits(int num){
int len = 1;
while(num>10){
num /= 10;
len++;
}
return len;
}
void generateStrand(){
int baseChoice = rand()%4, i;
genome *strandIterator, *newStrand;
baseData.adenineCount = 0;
baseData.thymineCount = 0;
baseData.cytosineCount = 0;
baseData.guanineCount = 0;
strand = (genome*)malloc(sizeof(genome));
strand->base = baseChoice==0?'A':(baseChoice==1?'T':(baseChoice==2?'C':'G'));
baseChoice==0?baseData.adenineCount++:(baseChoice==1?baseData.thymineCount++:(baseChoice==2?baseData.cytosineCount++:baseData.guanineCount++));
strand->next = NULL;
strandIterator = strand;
for(i=1;i<genomeLength;i++){
baseChoice = rand()%4;
newStrand = (genome*)malloc(sizeof(genome));
newStrand->base = baseChoice==0?'A':(baseChoice==1?'T':(baseChoice==2?'C':'G'));
baseChoice==0?baseData.adenineCount++:(baseChoice==1?baseData.thymineCount++:(baseChoice==2?baseData.cytosineCount++:baseData.guanineCount++));
newStrand->next = NULL;
strandIterator->next = newStrand;
strandIterator = newStrand;
}
}
genomeChange generateMutation(int swapWeight, int insertionWeight, int deletionWeight){
int mutationChoice = rand()%(swapWeight + insertionWeight + deletionWeight);
genomeChange mutationCommand;
mutationCommand.mutation = mutationChoice<swapWeight?'S':((mutationChoice>=swapWeight && mutationChoice<swapWeight+insertionWeight)?'I':'D');
mutationCommand.position = rand()%genomeLength;
return mutationCommand;
}
void printGenome(){
int rows, width = numDigits(genomeLength), len = 0,i,j;
lineLength = (genomeLength<lineLength)?genomeLength:lineLength;
rows = genomeLength/lineLength + (genomeLength%lineLength!=0);
genome* strandIterator = strand;
printf("\n\nGenome : \n--------\n");
for(i=0;i<rows;i++){
printf("\n%*d%3s",width,len,":");
for(j=0;j<lineLength && strandIterator!=NULL;j++){
printf("%c",strandIterator->base);
strandIterator = strandIterator->next;
}
len += lineLength;
}
while(strandIterator!=NULL){
printf("%c",strandIterator->base);
strandIterator = strandIterator->next;
}
printf("\n\nBase Counts\n-----------");
printf("\n%*c%3s%*d",width,'A',":",width,baseData.adenineCount);
printf("\n%*c%3s%*d",width,'T',":",width,baseData.thymineCount);
printf("\n%*c%3s%*d",width,'C',":",width,baseData.cytosineCount);
printf("\n%*c%3s%*d",width,'G',":",width,baseData.guanineCount);
printf("\n\nTotal:%*d",width,baseData.adenineCount + baseData.thymineCount + baseData.cytosineCount + baseData.guanineCount);
printf("\n");
}
void mutateStrand(int numMutations, int swapWeight, int insertionWeight, int deletionWeight){
int i,j,width,baseChoice;
genomeChange newMutation;
genome *strandIterator, *strandFollower, *newStrand;
for(i=0;i<numMutations;i++){
strandIterator = strand;
strandFollower = strand;
newMutation = generateMutation(swapWeight,insertionWeight,deletionWeight);
width = numDigits(genomeLength);
for(j=0;j<newMutation.position;j++){
strandFollower = strandIterator;
strandIterator = strandIterator->next;
}
if(newMutation.mutation=='S'){
if(strandIterator->base=='A'){
strandIterator->base='T';
printf("\nSwapping A at position : %*d with T",width,newMutation.position);
}
else if(strandIterator->base=='A'){
strandIterator->base='T';
printf("\nSwapping A at position : %*d with T",width,newMutation.position);
}
else if(strandIterator->base=='C'){
strandIterator->base='G';
printf("\nSwapping C at position : %*d with G",width,newMutation.position);
}
else{
strandIterator->base='C';
printf("\nSwapping G at position : %*d with C",width,newMutation.position);
}
}
else if(newMutation.mutation=='I'){
baseChoice = rand()%4;
newStrand = (genome*)malloc(sizeof(genome));
newStrand->base = baseChoice==0?'A':(baseChoice==1?'T':(baseChoice==2?'C':'G'));
printf("\nInserting %c at position : %*d",newStrand->base,width,newMutation.position);
baseChoice==0?baseData.adenineCount++:(baseChoice==1?baseData.thymineCount++:(baseChoice==2?baseData.cytosineCount++:baseData.guanineCount++));
newStrand->next = strandIterator;
strandFollower->next = newStrand;
genomeLength++;
}
else{
strandFollower->next = strandIterator->next;
strandIterator->next = NULL;
printf("\nDeleting %c at position : %*d",strandIterator->base,width,newMutation.position);
free(strandIterator);
genomeLength--;
}
}
}
int main(int argc,char* argv[])
{
int numMutations = 10, swapWeight = 10, insertWeight = 10, deleteWeight = 10;
if(argc==1||argc>6){
printf("Usage : %s <Genome Length> <Optional number of mutations> <Optional Swapping weight> <Optional Insertion weight> <Optional Deletion weight>\n",argv[0]);
return 0;
}
switch(argc){
case 2: genomeLength = atoi(argv[1]);
break;
case 3: genomeLength = atoi(argv[1]);
numMutations = atoi(argv[2]);
break;
case 4: genomeLength = atoi(argv[1]);
numMutations = atoi(argv[2]);
swapWeight = atoi(argv[3]);
break;
case 5: genomeLength = atoi(argv[1]);
numMutations = atoi(argv[2]);
swapWeight = atoi(argv[3]);
insertWeight = atoi(argv[4]);
break;
case 6: genomeLength = atoi(argv[1]);
numMutations = atoi(argv[2]);
swapWeight = atoi(argv[3]);
insertWeight = atoi(argv[4]);
deleteWeight = atoi(argv[5]);
break;
};
srand(time(NULL));
generateStrand();
printf("\nOriginal:");
printGenome();
mutateStrand(numMutations,swapWeight,insertWeight,deleteWeight);
printf("\n\nMutated:");
printGenome();
return 0;
}

View file

@ -0,0 +1,73 @@
(defun random_base ()
(random 4))
(defun basechar (base)
(char "ACTG" base))
(defun generate_genome (genome_length)
(let (genome '())
(loop for i below genome_length do
(push (random_base) genome))
(return-from generate_genome genome)))
(defun map_genome (genome)
(let (seq '())
(loop for n from (1- (length genome)) downto 0 do
(push (position (char genome n) "ACTG") seq))
seq))
(defun output_genome_info (genome &optional (genome_name "ORIGINAL"))
(let ((ac 0) (tc 0) (cc 0) (gc 0))
(format t "~% ---- ~a ----" genome_name)
(do ((n 0 (1+ n)))
((= n (length genome)))
(when (= 0 (mod n 50)) (format t "~& ~4d: " (1+ n)))
(case (nth n genome)
(0 (incf ac))
(1 (incf tc))
(2 (incf cc))
(3 (incf gc)))
(format t "~c" (basechar (nth n genome))))
(format t "~2%- Total : ~3d~%A : ~d C : ~d~%T : ~d G : ~d~2%" (length genome) ac tc cc gc)))
(defun insert_base (genome)
(let ((place (random (length genome)))
(base (random_base)))
(format t "Insert + ~c at ~3d~%"
(basechar base) (+ 1 place))
(if (= 0 place)
(push base genome)
(push base (cdr (nthcdr (1- place) genome))))
(return-from insert_base genome)))
(defun swap_base (genome)
(let ((place (random (length genome)))
(base (random_base)))
(format t "Swap ~c -> ~c at ~3d~%"
(basechar (nth place genome)) (basechar base) (+ 1 place))
(setf (nth place genome) base)
(return-from swap_base genome)))
(defun delete_base (genome)
(let ((place (random (length genome))))
(format t "Delete - ~c at ~3d~%"
(basechar (nth place genome)) (+ 1 place))
(if (= 0 place) (pop genome)
(pop (cdr (nthcdr (1- place) genome))))
(return-from delete_base genome)))
(defun mutate (genome_length n_mutations
&key (ins_w 10) (swp_w 10) (del_w 10)
(genome (generate_genome genome_length) has_genome))
(if has_genome (setf genome (map_genome genome)))
(output_genome_info genome)
(format t " ---- MUTATION SEQUENCE ----~%")
(do ((n 0 (1+ n)))
((= n n_mutations))
(setf mutation_type (random (+ ins_w swp_w del_w)))
(format t "~3d : " (1+ n))
(setf genome
(cond ((< mutation_type ins_w) (insert_base genome))
((< mutation_type (+ ins_w swp_w)) (swap_base genome))
(t (delete_base genome)))))
(output_genome_info genome "MUTATED"))

View file

@ -0,0 +1,74 @@
USING: assocs combinators.random formatting grouping io kernel
macros math math.statistics namespaces prettyprint quotations
random sequences sorting ;
IN: sequence-mutation
SYMBOL: verbose? ! Turn on to show mutation details.
! Off by default.
! Return a random base as a character.
: rand-base ( -- n ) "ACGT" random ;
! Generate a random dna sequence of length n.
: <dna> ( n -- seq ) [ rand-base ] "" replicate-as ;
! Prettyprint a dna sequence in blocks of n.
: .dna ( seq n -- )
"SEQUENCE:" print [ group ] keep
[ * swap " %3d: %s\n" printf ] curry each-index ;
! Show a histogram of bases in a dna sequence and their total.
: show-counts ( seq -- )
"BASE COUNTS:" print histogram >alist [ first ] sort-with
[ [ " %c: %3d\n" printf ] assoc-each ]
[ "TOTAL: " write [ second ] [ + ] map-reduce . ] bi ;
! Prettyprint the overall state of a dna sequence.
: show-dna ( seq -- ) [ 50 .dna nl ] [ show-counts nl ] bi ;
! Call a quotation only if verbose? is on.
: log ( quot -- ) verbose? get [ call ] [ drop ] if ; inline
! Set index n to a random base.
: bswap ( n seq -- seq' )
[ rand-base ] 2dip 3dup [ nth ] keepd spin
[ " index %3d: swapping %c with %c\n" printf ] 3curry log
[ set-nth ] keep ;
! Remove the base at index n.
: bdelete ( n seq -- seq' )
2dup dupd nth [ " index %3d: deleting %c\n" printf ]
2curry log remove-nth ;
! Insert a random base at index n.
: binsert ( n seq -- seq' )
[ rand-base ] 2dip over reach
[ " index %3d: inserting %c\n" printf ] 2curry log
insert-nth ;
! Allow "passing" probabilities to casep. This is necessary
! because casep is a macro.
MACRO: build-casep-seq ( seq -- quot )
{ [ bswap ] [ bdelete ] [ binsert ] } zip 1quotation ;
! Mutate a dna sequence according to some weights.
! For example,
! "ACGT" { 0.1 0.3 0.6 } mutate
! means swap with 0.1 probability, delete with 0.3 probability,
! and insert with 0.6 probability.
: mutate ( dna-seq weights-seq -- dna-seq' )
[ [ length random ] keep ] [ build-casep-seq ] bi* casep ;
inline
! Prettyprint a sequence of weights.
: show-weights ( seq -- )
"MUTATION PROBABILITIES:" print
" swap: %.2f\n delete: %.2f\n insert: %.2f\n\n" vprintf
;
: main ( -- )
verbose? on "ORIGINAL " write 200 <dna> dup show-dna 10
{ 0.2 0.2 0.6 } dup show-weights "MUTATION LOG:" print
[ mutate ] curry times nl "MUTATED " write show-dna ;
MAIN: main

View file

@ -0,0 +1,62 @@
'' Rosetta Code problem: https://rosettacode.org/wiki/Bioinformatics/Sequence_mutation
'' by Jjuanhdez, 05/2023
Randomize Timer
Dim As Integer r, i
r = Int(Rnd * (300))
Dim Shared As String dnaS
For i = 1 To 200 + r : dnaS += Mid("ACGT", Int(Rnd * (4))+1, 1) : Next
Sub show()
Dim As Integer acgt(4), i, j, x, total
For i = 1 To Len(dnaS)
x = Instr("ACGT", Mid(dnaS, i, 1))
acgt(x) += 1
Next
For i = 1 To 4 : total += acgt(i) : Next
For i = 1 To Len(dnaS) Step 50
Print i; ":"; !"\t";
For j = 0 To 49 Step 10
Print Mid(dnaS, i+j, 10); " ";
Next
Print
Next
Print !"\nBase counts: A:"; acgt(1); ", C:"; acgt(2); ", G:"; acgt(3); ", T:"; acgt(4); ", total:"; total
End Sub
Sub mutate()
Dim As Integer i, p
Dim As String sdiS, repS, wasS
Print
For i = 1 To 10
p = Int(Rnd * (Len(dnaS))) + 1
sdiS = Mid("SDI", Int(Rnd * (3)) + 1, 1)
repS = Mid("ACGT", Int(Rnd * (4)) + 1, 1)
wasS = Mid(dnaS, p, 1)
Select Case sdiS
Case "S"
Mid(dnaS, p, 1) = repS
Print "swapped "; wasS; " at "; p; " for "; repS
Case "D"
dnaS = Left(dnaS, p - 1) + Right(dnaS, Len(dnaS) - p)
Print "deleted "; wasS; " at "; p
Case "I"
dnaS = Left(dnaS, p - 1) + repS + Right(dnaS, (Len(dnaS) - p + 1))
Print "inserted "; repS; " at "; p; ", before "; wasS
End Select
Next
Print
End Sub
show()
mutate()
show()
Sleep

View file

@ -0,0 +1,99 @@
package main
import (
"fmt"
"math/rand"
"sort"
"time"
)
const bases = "ACGT"
// 'w' contains the weights out of 300 for each
// of swap, delete or insert in that order.
func mutate(dna string, w [3]int) string {
le := len(dna)
// get a random position in the dna to mutate
p := rand.Intn(le)
// get a random number between 0 and 299 inclusive
r := rand.Intn(300)
bytes := []byte(dna)
switch {
case r < w[0]: // swap
base := bases[rand.Intn(4)]
fmt.Printf(" Change @%3d %q to %q\n", p, bytes[p], base)
bytes[p] = base
case r < w[0]+w[1]: // delete
fmt.Printf(" Delete @%3d %q\n", p, bytes[p])
copy(bytes[p:], bytes[p+1:])
bytes = bytes[0 : le-1]
default: // insert
base := bases[rand.Intn(4)]
bytes = append(bytes, 0)
copy(bytes[p+1:], bytes[p:])
fmt.Printf(" Insert @%3d %q\n", p, base)
bytes[p] = base
}
return string(bytes)
}
// Generate a random dna sequence of given length.
func generate(le int) string {
bytes := make([]byte, le)
for i := 0; i < le; i++ {
bytes[i] = bases[rand.Intn(4)]
}
return string(bytes)
}
// Pretty print dna and stats.
func prettyPrint(dna string, rowLen int) {
fmt.Println("SEQUENCE:")
le := len(dna)
for i := 0; i < le; i += rowLen {
k := i + rowLen
if k > le {
k = le
}
fmt.Printf("%5d: %s\n", i, dna[i:k])
}
baseMap := make(map[byte]int) // allows for 'any' base
for i := 0; i < le; i++ {
baseMap[dna[i]]++
}
var bases []byte
for k := range baseMap {
bases = append(bases, k)
}
sort.Slice(bases, func(i, j int) bool { // get bases into alphabetic order
return bases[i] < bases[j]
})
fmt.Println("\nBASE COUNT:")
for _, base := range bases {
fmt.Printf(" %c: %3d\n", base, baseMap[base])
}
fmt.Println(" ------")
fmt.Println(" Σ:", le)
fmt.Println(" ======\n")
}
// Express weights as a string.
func wstring(w [3]int) string {
return fmt.Sprintf(" Change: %d\n Delete: %d\n Insert: %d\n", w[0], w[1], w[2])
}
func main() {
rand.Seed(time.Now().UnixNano())
dna := generate(250)
prettyPrint(dna, 50)
muts := 10
w := [3]int{100, 100, 100} // use e.g. {0, 300, 0} to choose only deletions
fmt.Printf("WEIGHTS (ex 300):\n%s\n", wstring(w))
fmt.Printf("MUTATIONS (%d):\n", muts)
for i := 0; i < muts; i++ {
dna = mutate(dna, w)
}
fmt.Println()
prettyPrint(dna, 50)
}

View file

@ -0,0 +1,80 @@
import Data.List (group, sort)
import Data.List.Split (chunksOf)
import System.Random (Random, randomR, random, newStdGen, randoms, getStdRandom)
import Text.Printf (PrintfArg(..), fmtChar, fmtPrecision, formatString, IsChar(..), printf)
data Mutation = Swap | Delete | Insert deriving (Show, Eq, Ord, Enum, Bounded)
data DNABase = A | C | G | T deriving (Show, Read, Eq, Ord, Enum, Bounded)
type DNASequence = [DNABase]
data Result = Swapped Mutation Int (DNABase, DNABase)
| InsertDeleted Mutation Int DNABase
instance Random DNABase where
randomR (a, b) g = case randomR (fromEnum a, fromEnum b) g of (x, y) -> (toEnum x, y)
random = randomR (minBound, maxBound)
instance Random Mutation where
randomR (a, b) g = case randomR (fromEnum a, fromEnum b) g of (x, y) -> (toEnum x, y)
random = randomR (minBound, maxBound)
instance PrintfArg DNABase where
formatArg x fmt = formatString (show x) (fmt { fmtChar = 's', fmtPrecision = Nothing })
instance PrintfArg Mutation where
formatArg x fmt = formatString (show x) (fmt { fmtChar = 's', fmtPrecision = Nothing })
instance IsChar DNABase where
toChar = head . show
fromChar = read . pure
chunkedDNASequence :: DNASequence -> [(Int, [DNABase])]
chunkedDNASequence = zip [50,100..] . chunksOf 50
baseCounts :: DNASequence -> [(DNABase, Int)]
baseCounts = fmap ((,) . head <*> length) . group . sort
newSequence :: Int -> IO DNASequence
newSequence n = take n . randoms <$> newStdGen
mutateSequence :: DNASequence -> IO (Result, DNASequence)
mutateSequence [] = fail "empty dna sequence"
mutateSequence ds = randomMutation >>= mutate ds
where
randomMutation = head . randoms <$> newStdGen
mutate xs m = do
i <- randomIndex (length xs)
case m of
Swap -> randomDNA >>= \d -> pure (Swapped Swap i (xs !! pred i, d), swapElement i d xs)
Insert -> randomDNA >>= \d -> pure (InsertDeleted Insert i d, insertElement i d xs)
Delete -> pure (InsertDeleted Delete i (xs !! pred i), dropElement i xs)
where
dropElement i xs = take (pred i) xs <> drop i xs
insertElement i e xs = take i xs <> [e] <> drop i xs
swapElement i a xs = take (pred i) xs <> [a] <> drop i xs
randomIndex n = getStdRandom (randomR (1, n))
randomDNA = head . randoms <$> newStdGen
mutate :: Int -> DNASequence -> IO DNASequence
mutate 0 s = pure s
mutate n s = do
(r, ms) <- mutateSequence s
case r of
Swapped m i (a, b) -> printf "%6s @ %-3d : %s -> %s \n" m i a b
InsertDeleted m i a -> printf "%6s @ %-3d : %s\n" m i a
mutate (pred n) ms
main :: IO ()
main = do
ds <- newSequence 200
putStrLn "\nInitial Sequence:" >> showSequence ds
putStrLn "\nBase Counts:" >> showBaseCounts ds
showSumBaseCounts ds
ms <- mutate 10 ds
putStrLn "\nMutated Sequence:" >> showSequence ms
putStrLn "\nBase Counts:" >> showBaseCounts ms
showSumBaseCounts ms
where
showSequence = mapM_ (uncurry (printf "%3d: %s\n")) . chunkedDNASequence
showBaseCounts = mapM_ (uncurry (printf "%s: %3d\n")) . baseCounts
showSumBaseCounts xs = putStrLn (replicate 6 '-') >> printf "Σ: %d\n\n" (length xs)

View file

@ -0,0 +1,36 @@
ACGT=: 'ACGT'
MUTS=: ;: 'del ins mut'
NB. generate sequence of size y of uniformly selected nucleotides.
NB. represent sequences as ints in range i.4 pretty printed. nuc
NB. defined separately to avoid fixing value inside mutation
NB. functions.
nuc=: monad : '?4'
dna=: nuc"0 @ i.
NB. randomly mutate nucleotide at a random index by deletion insertion
NB. or mutation of a nucleotide.
del=: {.,[:}.}.
ins=: {.,nuc@],}.
mut=: {.,nuc@],[:}.}.
NB. pretty print nucleotides in rows of 50 with numbering
seq=: [: (;~ [: (4&":"0) 50*i.@#) _50]\{&ACGT
sim=: monad define
'n k ws'=. y NB. initial size, mutations, and weights for mutations
ws=. (% +/) ws NB. normalize weights
A=.0$]D0=.D=. dna n NB. initial dna and history of actions
NB. k times do a random action according to weights and record it
for. i.k do.
D=.". action=. (":?#D),' ',(":MUTS{::~(+/\ws)I.?0),' D'
A=. action ; A
end.
echo 'actions';,. A-.a:
echo ('mutation';'probability') , MUTS ,. <"0 ws
('start';'end'),.(seq D0) ,: seq D
)
simulate=: (sim@(1 1 1&; &. |. ))`sim@.(3=#)

View file

@ -0,0 +1,104 @@
import java.io.BufferedReader;
import java.io.IOException;
import java.io.StringReader;
import java.util.ArrayList;
import java.util.List;
import java.util.Random;
class Program {
List<Character> sequence;
Random random;
SequenceMutation() {
sequence = new ArrayList<>();
random = new Random();
}
void generate(int amount) {
for (int count = 0; count < amount; count++)
sequence.add(randomBase());
}
void mutate(int amount) {
int index;
for (int count = 0; count < amount; count++) {
index = random.nextInt(0, sequence.size());
switch (random.nextInt(0, 3)) {
case 0 -> sequence.set(index, randomBase());
case 1 -> sequence.remove(index);
case 2 -> sequence.add(index, randomBase());
}
}
}
private char randomBase() {
return switch (random.nextInt(0, 4)) {
case 0 -> 'A';
case 1 -> 'C';
case 2 -> 'G';
case 3 -> 'T';
default -> '?';
};
}
private Base count(String string) {
int a = 0, c = 0, g = 0, t = 0;
for (char base : string.toCharArray()) {
switch (base) {
case 'A' -> a++;
case 'C' -> c++;
case 'G' -> g++;
case 'T' -> t++;
}
}
return new Base(a, c, g, t);
}
/* used exclusively for count totals */
private record Base(int a, int c, int g, int t) {
int total() {
return a + c + g + t;
}
@Override
public String toString() {
return "[A %2d, C %2d, G %2d, T %2d]".formatted(a, c, g, t);
}
}
@Override
public String toString() {
StringBuilder string = new StringBuilder();
StringBuilder stringB = new StringBuilder();
String newline = System.lineSeparator();
for (int index = 0; index < sequence.size(); index++) {
if (index != 0 && index % 50 == 0)
string.append(newline);
string.append(sequence.get(index));
stringB.append(sequence.get(index));
}
try {
BufferedReader reader = new BufferedReader(new StringReader(string.toString()));
string = new StringBuilder();
int count = 0;
String line;
while ((line = reader.readLine()) != null) {
string.append(count++);
string.append(" %-50s ".formatted(line));
string.append(count(line));
string.append(newline);
}
} catch (IOException exception) {
/* ignore */
}
string.append(newline);
Base bases = count(stringB.toString());
int total = bases.total();
string.append("Total of %d bases%n".formatted(total));
string.append("A %3d (%.2f%%)%n".formatted(bases.a, ((double) bases.a / total) * 100));
string.append("C %3d (%.2f%%)%n".formatted(bases.c, ((double) bases.c / total) * 100));
string.append("G %3d (%.2f%%)%n".formatted(bases.g, ((double) bases.g / total) * 100));
string.append("T %3d (%.2f%%)%n".formatted(bases.t, ((double) bases.t / total) * 100));
return string.toString();
}
}

View file

@ -0,0 +1,113 @@
import java.util.Arrays;
import java.util.Random;
public class SequenceMutation {
public static void main(String[] args) {
SequenceMutation sm = new SequenceMutation();
sm.setWeight(OP_CHANGE, 3);
String sequence = sm.generateSequence(250);
System.out.println("Initial sequence:");
printSequence(sequence);
int count = 10;
for (int i = 0; i < count; ++i)
sequence = sm.mutateSequence(sequence);
System.out.println("After " + count + " mutations:");
printSequence(sequence);
}
public SequenceMutation() {
totalWeight_ = OP_COUNT;
Arrays.fill(operationWeight_, 1);
}
public String generateSequence(int length) {
char[] ch = new char[length];
for (int i = 0; i < length; ++i)
ch[i] = getRandomBase();
return new String(ch);
}
public void setWeight(int operation, int weight) {
totalWeight_ -= operationWeight_[operation];
operationWeight_[operation] = weight;
totalWeight_ += weight;
}
public String mutateSequence(String sequence) {
char[] ch = sequence.toCharArray();
int pos = random_.nextInt(ch.length);
int operation = getRandomOperation();
if (operation == OP_CHANGE) {
char b = getRandomBase();
System.out.println("Change base at position " + pos + " from "
+ ch[pos] + " to " + b);
ch[pos] = b;
} else if (operation == OP_ERASE) {
System.out.println("Erase base " + ch[pos] + " at position " + pos);
char[] newCh = new char[ch.length - 1];
System.arraycopy(ch, 0, newCh, 0, pos);
System.arraycopy(ch, pos + 1, newCh, pos, ch.length - pos - 1);
ch = newCh;
} else if (operation == OP_INSERT) {
char b = getRandomBase();
System.out.println("Insert base " + b + " at position " + pos);
char[] newCh = new char[ch.length + 1];
System.arraycopy(ch, 0, newCh, 0, pos);
System.arraycopy(ch, pos, newCh, pos + 1, ch.length - pos);
newCh[pos] = b;
ch = newCh;
}
return new String(ch);
}
public static void printSequence(String sequence) {
int[] count = new int[BASES.length];
for (int i = 0, n = sequence.length(); i < n; ++i) {
if (i % 50 == 0) {
if (i != 0)
System.out.println();
System.out.printf("%3d: ", i);
}
char ch = sequence.charAt(i);
System.out.print(ch);
for (int j = 0; j < BASES.length; ++j) {
if (BASES[j] == ch) {
++count[j];
break;
}
}
}
System.out.println();
System.out.println("Base counts:");
int total = 0;
for (int j = 0; j < BASES.length; ++j) {
total += count[j];
System.out.print(BASES[j] + ": " + count[j] + ", ");
}
System.out.println("Total: " + total);
}
private char getRandomBase() {
return BASES[random_.nextInt(BASES.length)];
}
private int getRandomOperation() {
int n = random_.nextInt(totalWeight_), op = 0;
for (int weight = 0; op < OP_COUNT; ++op) {
weight += operationWeight_[op];
if (n < weight)
break;
}
return op;
}
private final Random random_ = new Random();
private int[] operationWeight_ = new int[OP_COUNT];
private int totalWeight_ = 0;
private static final int OP_CHANGE = 0;
private static final int OP_ERASE = 1;
private static final int OP_INSERT = 2;
private static final int OP_COUNT = 3;
private static final char[] BASES = {'A', 'C', 'G', 'T'};
}

View file

@ -0,0 +1,157 @@
// Basic set-up
const numBases = 250
const numMutations = 30
const bases = ['A', 'C', 'G', 'T'];
// Utility functions
/**
* Return a shallow copy of an array
* @param {Array<*>} arr
* @returns {*[]}
*/
const copy = arr => [...arr];
/**
* Get a random int up to but excluding the the given number
* @param {number} max
* @returns {number}
*/
const randTo = max => (Math.random() * max) | 0;
/**
* Given an array return a random element and the index of that element from
* the array.
* @param {Array<*>} arr
* @returns {[*[], number]}
*/
const randSelect = arr => {
const at = randTo(arr.length);
return [arr[at], at];
};
/**
* Given a number or string, return a left padded string
* @param {string|number} v
* @returns {string}
*/
const pad = v => ('' + v).padStart(4, ' ');
/**
* Count the number of elements that match the given value in an array
* @param {Array<string>} arr
* @returns {function(string): number}
*/
const filterCount = arr => s => arr.filter(e => e === s).length;
/**
* Utility logging function
* @param {string|number} v
* @param {string|number} n
*/
const print = (v, n) => console.log(`${pad(v)}:\t${n}`)
/**
* Utility function to randomly select a new base, and an index in the given
* sequence.
* @param {Array<string>} seq
* @param {Array<string>} bases
* @returns {[string, string, number]}
*/
const getVars = (seq, bases) => {
const [newBase, _] = randSelect(bases);
const [extBase, randPos] = randSelect(seq);
return [newBase, extBase, randPos];
};
// Bias the operations
/**
* Given a map of function to ratio, return an array of those functions
* appearing ratio number of times in the array.
* @param weightMap
* @returns {Array<function>}
*/
const weightedOps = weightMap => {
return [...weightMap.entries()].reduce((p, [op, weight]) =>
[...p, ...(Array(weight).fill(op))], []);
};
// Pretty Print functions
const prettyPrint = seq => {
let idx = 0;
const rem = seq.reduce((p, c) => {
const s = p + c;
if (s.length === 50) {
print(idx, s);
idx = idx + 50;
return '';
}
return s;
}, '');
if (rem !== '') {
print(idx, rem);
}
}
const printBases = seq => {
const filterSeq = filterCount(seq);
let tot = 0;
[...bases].forEach(e => {
const cnt = filterSeq(e);
print(e, cnt);
tot = tot + cnt;
})
print('Σ', tot);
}
// Mutation definitions
const swap = ([hist, seq]) => {
const arr = copy(seq);
const [newBase, extBase, randPos] = getVars(arr, bases);
arr.splice(randPos, 1, newBase);
return [[...hist, `Swapped ${extBase} for ${newBase} at ${randPos}`], arr];
};
const del = ([hist, seq]) => {
const arr = copy(seq);
const [newBase, extBase, randPos] = getVars(arr, bases);
arr.splice(randPos, 1);
return [[...hist, `Deleted ${extBase} at ${randPos}`], arr];
}
const insert = ([hist, seq]) => {
const arr = copy(seq);
const [newBase, extBase, randPos] = getVars(arr, bases);
arr.splice(randPos, 0, newBase);
return [[...hist, `Inserted ${newBase} at ${randPos}`], arr];
}
// Create the starting sequence
const seq = Array(numBases).fill(undefined).map(
() => randSelect(bases)[0]);
// Create a weighted set of mutations
const weightMap = new Map()
.set(swap, 1)
.set(del, 1)
.set(insert, 1);
const operations = weightedOps(weightMap);
const mutations = Array(numMutations).fill(undefined).map(
() => randSelect(operations)[0]);
// Mutate the sequence
const [hist, mut] = mutations.reduce((p, c) => c(p), [[], seq]);
console.log('ORIGINAL SEQUENCE:')
prettyPrint(seq);
console.log('\nBASE COUNTS:')
printBases(seq);
console.log('\nMUTATION LOG:')
hist.forEach((e, i) => console.log(`${i}:\t${e}`));
console.log('\nMUTATED SEQUENCE:')
prettyPrint(mut);
console.log('\nMUTATED BASE COUNTS:')
printBases(mut);

View file

@ -0,0 +1,53 @@
dnabases = ['A', 'C', 'G', 'T']
randpos(seq) = rand(1:length(seq)) # 1
mutateat(pos, seq) = (s = seq[:]; s[pos] = rand(dnabases); s) # 2-1
deleteat(pos, seq) = [seq[1:pos-1]; seq[pos+1:end]] # 2-2
randinsertat(pos, seq) = [seq[1:pos]; rand(dnabases); seq[pos+1:end]] # 2-3
function weightedmutation(seq, pos, weights=[1, 1, 1], verbose=true) # Extra credit
p, r = weights ./ sum(weights), rand()
f = (r <= p[1]) ? mutateat : (r < p[1] + p[2]) ? deleteat : randinsertat
verbose && print("Mutate by ", f == mutateat ? "swap" :
f == deleteat ? "delete" : "insert")
return f(pos, seq)
end
function weightedrandomsitemutation(seq, weights=[1, 1, 1], verbose=true)
position = randpos(seq)
newseq = weightedmutation(seq, position, weights, verbose)
verbose && println(" at position $position")
return newseq
end
randdnasequence(n) = rand(dnabases, n) # 3
function dnasequenceprettyprint(seq, colsize=50) # 4
println(length(seq), "nt DNA sequence:\n")
rows = [seq[i:min(length(seq), i + colsize - 1)] for i in 1:colsize:length(seq)]
for (i, r) in enumerate(rows)
println(lpad(colsize * (i - 1), 5), " ", String(r))
end
bases = [[c, 0] for c in dnabases]
for c in seq, base in bases
if c == base[1]
base[2] += 1
end
end
println("\nNucleotide counts:\n")
for base in bases
println(lpad(base[1], 10), lpad(string(base[2]), 12))
end
println(lpad("Other", 10), lpad(string(length(seq) - sum(x[2] for x in bases)), 12))
println(" _________________\n", lpad("Total", 10), lpad(string(length(seq)), 12))
end
function testbioseq()
sequence = randdnasequence(500)
dnasequenceprettyprint(sequence)
for _ in 1:10 # 5
sequence = weightedrandomsitemutation(sequence)
end
println("\n Mutated:"); dnasequenceprettyprint(sequence) # 6
end
testbioseq()

View file

@ -0,0 +1,29 @@
math.randomseed(os.time())
bases = {"A","C","T","G"}
function randbase() return bases[math.random(#bases)] end
function mutate(seq)
local i,h = math.random(#seq), "%-6s %3s at %3d"
local old,new = seq:sub(i,i), randbase()
local ops = {
function(s) h=h:format("Swap", old..">"..new, i) return s:sub(1,i-1)..new..s:sub(i+1) end,
function(s) h=h:format("Delete", " -"..old, i) return s:sub(1,i-1)..s:sub(i+1) end,
function(s) h=h:format("Insert", " +"..new, i) return s:sub(1,i-1)..new..s:sub(i) end,
}
local weighted = { 1,1,2,3 }
local n = weighted[math.random(#weighted)]
return ops[n](seq), h
end
local seq,hist="",{} for i = 1, 200 do seq=seq..randbase() end
print("ORIGINAL:")
prettyprint(seq)
print()
for i = 1, 10 do seq,h=mutate(seq) hist[#hist+1]=h end
print("MUTATIONS:")
for i,h in ipairs(hist) do print(" "..h) end
print()
print("MUTATED:")
prettyprint(seq)

View file

@ -0,0 +1,35 @@
SeedRandom[13122345];
seq = BioSequence["DNA", "ATAAACGTACGTTTTTAGGCT"];
randompos = RandomInteger[seq["SequenceLength"]];
seq = StringReplacePart[seq, RandomChoice[{"A", "T", "C", "G"}], {randompos, randompos}];
randompos = RandomInteger[seq["SequenceLength"]];
seq = StringReplacePart[seq, "", {randompos, randompos}];
randompos = RandomInteger[seq["SequenceLength"]];
seq = StringInsert[seq, RandomChoice[{"A", "T", "C", "G"}], randompos];
seq = BioSequence["DNA", StringJoin@RandomChoice[{"A", "T", "C", "G"}, 250]];
size = 50;
parts = StringPartition[seq["SequenceString"], UpTo[size]];
begins = Most[Accumulate[Prepend[StringLength /@ parts, 1]]];
ends = Rest[Accumulate[Prepend[StringLength /@ parts, 0]]];
StringRiffle[MapThread[ToString[#1] <> "-" <> ToString[#2] <> ": " <> #3 &, {begins, ends, parts}], "\n"]
Tally[Characters[seq["SequenceString"]]]
Do[
type = RandomChoice[{1, 2, 3}];
Switch[type, 1,
randompos = RandomInteger[seq["SequenceLength"]];
seq = StringReplacePart[seq, RandomChoice[{"A", "T", "C", "G"}], {randompos, randompos}];
, 2,
randompos = RandomInteger[seq["SequenceLength"]];
seq = StringReplacePart[seq, "", {randompos, randompos}];
, 3,
randompos = RandomInteger[seq["SequenceLength"]];
seq = StringInsert[seq, RandomChoice[{"A", "T", "C", "G"}], randompos];
]
,
{10}
]
parts = StringPartition[seq["SequenceString"], UpTo[size]];
begins = Most[Accumulate[Prepend[StringLength /@ parts, 1]]];
ends = Rest[Accumulate[Prepend[StringLength /@ parts, 0]]];
StringRiffle[MapThread[ToString[#1] <> "-" <> ToString[#2] <> ": " <> #3 &, {begins, ends, parts}], "\n"]
Tally[Characters[seq["SequenceString"]]]

View file

@ -0,0 +1,117 @@
import random
import strformat
import strutils
type
# Enumeration type for bases.
Base {.pure.} = enum A, C, G, T, Other = "other"
# Sequence of bases.
DnaSequence = string
# Kind of mutation.
Mutation = enum mutSwap, mutDelete, mutInsert
const MaxBaseVal = ord(Base.high) - 1 # Maximum base value.
#---------------------------------------------------------------------------------------------------
template toChar(base: Base): char = ($base)[0]
#---------------------------------------------------------------------------------------------------
proc newDnaSeq(length: Natural): DnaSequence =
## Create a DNA sequence of given length.
result = newStringOfCap(length)
for _ in 1..length:
result.add($Base(rand(MaxBaseVal)))
#---------------------------------------------------------------------------------------------------
proc mutate(dnaSeq: var DnaSequence) =
## Mutate a sequence (it is changed in place).
# Choose randomly the position of mutation.
let idx = rand(dnaSeq.high)
# Choose randomly the kind of mutation.
let mut = Mutation(rand(ord(Mutation.high)))
# Apply the mutation.
case mut
of mutSwap:
let newBase = Base(rand(MaxBaseVal))
echo fmt"Changing base at position {idx + 1} from {dnaSeq[idx]} to {newBase}"
dnaSeq[idx] = newBase.toChar
of mutDelete:
echo fmt"Deleting base {dnaSeq[idx]} at position {idx + 1}"
dnaSeq.delete(idx, idx)
of mutInsert:
let newBase = Base(rand(MaxBaseVal))
echo fmt"Inserting base {newBase} at position {idx + 1}"
dnaSeq.insert($newBase, idx)
#---------------------------------------------------------------------------------------------------
proc display(dnaSeq: DnaSequence) =
## Display a DNA sequence using EMBL format.
var counts: array[Base, Natural] # Count of bases.
for c in dnaSeq:
inc counts[parseEnum[Base]($c, Other)] # Use Other as default value.
# Display the SQ line.
var sqline = fmt"SQ {dnaSeq.len} BP; "
for (base, count) in counts.pairs:
sqline &= fmt"{count} {base}; "
echo sqline
# Display the sequence.
var idx = 0
var row = newStringOfCap(80)
var remaining = dnaSeq.len
while remaining > 0:
row.setLen(0)
row.add(" ")
# Add groups of 10 bases.
for group in 1..6:
let nextIdx = idx + min(10, remaining)
for i in idx..<nextIdx:
row.add($dnaSeq[i])
row.add(' ')
dec remaining, nextIdx - idx
idx = nextIdx
if remaining == 0:
break
# Append the number of the last base in the row.
row.add(spaces(72 - row.len))
row.add(fmt"{idx:>8}")
echo row
# Add termination.
echo "//"
#———————————————————————————————————————————————————————————————————————————————————————————————————
randomize()
var dnaSeq = newDnaSeq(200)
echo "Initial sequence"
echo "———————————————\n"
dnaSeq.display()
echo "\nMutations"
echo "—————————\n"
for _ in 1..10:
dnaSeq.mutate()
echo "\nMutated sequence"
echo "————————————————\n"
dnaSeq.display()

View file

@ -0,0 +1,44 @@
use strict;
use warnings;
use feature 'say';
my @bases = <A C G T>;
my $dna;
$dna .= $bases[int rand 4] for 1..200;
my %cnt;
$cnt{$_}++ for split //, $dna;
sub pretty {
my($string) = @_;
my $chunk = 10;
my $wrap = 5 * ($chunk+1);
($string =~ s/(.{$chunk})/$1 /gr) =~ s/(.{$wrap})/$1\n/gr;
}
sub mutate {
my($dna,$count) = @_;
my $orig = $dna;
substr($dna,rand length $dna,1) = $bases[int rand 4] while $count > diff($orig, $dna) =~ tr/acgt//;
$dna
}
sub diff {
my($orig, $repl) = @_;
for my $i (0 .. -1+length $orig) {
substr($repl,$i,1, lc substr $repl,$i,1) if substr($orig,$i,1) ne substr($repl,$i,1);
}
$repl;
}
say "Original DNA strand:\n" . pretty($dna);
say "Total bases: ". length $dna;
say "$_: $cnt{$_}" for @bases;
my $mutate = mutate($dna, 10);
%cnt = ();
$cnt{$_}++ for split //, $mutate;
say "\nMutated DNA strand:\n" . pretty diff $dna, $mutate;
say "Total bases: ". length $mutate;
say "$_: $cnt{$_}" for @bases;

View file

@ -0,0 +1,37 @@
(phixonline)-->
<span style="color: #004080;">string</span> <span style="color: #000000;">dna</span> <span style="color: #0000FF;">=</span> <span style="color: #7060A8;">repeat</span><span style="color: #0000FF;">(</span><span style="color: #008000;">' '</span><span style="color: #0000FF;">,</span><span style="color: #000000;">200</span><span style="color: #0000FF;">+</span><span style="color: #7060A8;">rand</span><span style="color: #0000FF;">(</span><span style="color: #000000;">300</span><span style="color: #0000FF;">))</span>
<span style="color: #008080;">for</span> <span style="color: #000000;">i</span><span style="color: #0000FF;">=</span><span style="color: #000000;">1</span> <span style="color: #008080;">to</span> <span style="color: #7060A8;">length</span><span style="color: #0000FF;">(</span><span style="color: #000000;">dna</span><span style="color: #0000FF;">)</span> <span style="color: #008080;">do</span> <span style="color: #000000;">dna</span><span style="color: #0000FF;">[</span><span style="color: #000000;">i</span><span style="color: #0000FF;">]</span> <span style="color: #0000FF;">=</span> <span style="color: #008000;">"ACGT"</span><span style="color: #0000FF;">[</span><span style="color: #7060A8;">rand</span><span style="color: #0000FF;">(</span><span style="color: #000000;">4</span><span style="color: #0000FF;">)]</span> <span style="color: #008080;">end</span> <span style="color: #008080;">for</span>
<span style="color: #008080;">procedure</span> <span style="color: #000000;">show</span><span style="color: #0000FF;">()</span>
<span style="color: #004080;">sequence</span> <span style="color: #000000;">acgt</span> <span style="color: #0000FF;">=</span> <span style="color: #7060A8;">repeat</span><span style="color: #0000FF;">(</span><span style="color: #000000;">0</span><span style="color: #0000FF;">,</span><span style="color: #000000;">5</span><span style="color: #0000FF;">)</span>
<span style="color: #008080;">for</span> <span style="color: #000000;">i</span><span style="color: #0000FF;">=</span><span style="color: #000000;">1</span> <span style="color: #008080;">to</span> <span style="color: #7060A8;">length</span><span style="color: #0000FF;">(</span><span style="color: #000000;">dna</span><span style="color: #0000FF;">)</span> <span style="color: #008080;">do</span>
<span style="color: #000000;">acgt</span><span style="color: #0000FF;">[</span><span style="color: #7060A8;">find</span><span style="color: #0000FF;">(</span><span style="color: #000000;">dna</span><span style="color: #0000FF;">[</span><span style="color: #000000;">i</span><span style="color: #0000FF;">],</span><span style="color: #008000;">"ACGT"</span><span style="color: #0000FF;">)]</span> <span style="color: #0000FF;">+=</span> <span style="color: #000000;">1</span>
<span style="color: #008080;">end</span> <span style="color: #008080;">for</span>
<span style="color: #000000;">acgt</span><span style="color: #0000FF;">[$]</span> <span style="color: #0000FF;">=</span> <span style="color: #7060A8;">sum</span><span style="color: #0000FF;">(</span><span style="color: #000000;">acgt</span><span style="color: #0000FF;">)</span>
<span style="color: #004080;">sequence</span> <span style="color: #000000;">s</span> <span style="color: #0000FF;">=</span> <span style="color: #7060A8;">split</span><span style="color: #0000FF;">(</span><span style="color: #7060A8;">trim</span><span style="color: #0000FF;">(</span><span style="color: #7060A8;">join_by</span><span style="color: #0000FF;">(</span><span style="color: #7060A8;">split</span><span style="color: #0000FF;">(</span><span style="color: #7060A8;">join_by</span><span style="color: #0000FF;">(</span><span style="color: #000000;">dna</span><span style="color: #0000FF;">,</span><span style="color: #000000;">1</span><span style="color: #0000FF;">,</span><span style="color: #000000;">10</span><span style="color: #0000FF;">,</span><span style="color: #008000;">""</span><span style="color: #0000FF;">),</span><span style="color: #008000;">"\n"</span><span style="color: #0000FF;">),</span><span style="color: #000000;">1</span><span style="color: #0000FF;">,</span><span style="color: #000000;">5</span><span style="color: #0000FF;">,</span><span style="color: #008000;">" "</span><span style="color: #0000FF;">)),</span><span style="color: #008000;">"\n"</span><span style="color: #0000FF;">)</span>
<span style="color: #008080;">for</span> <span style="color: #000000;">i</span><span style="color: #0000FF;">=</span><span style="color: #000000;">1</span> <span style="color: #008080;">to</span> <span style="color: #7060A8;">length</span><span style="color: #0000FF;">(</span><span style="color: #000000;">s</span><span style="color: #0000FF;">)</span> <span style="color: #008080;">do</span>
<span style="color: #7060A8;">printf</span><span style="color: #0000FF;">(</span><span style="color: #000000;">1</span><span style="color: #0000FF;">,</span><span style="color: #008000;">"%3d: %s\n"</span><span style="color: #0000FF;">,{(</span><span style="color: #000000;">i</span><span style="color: #0000FF;">-</span><span style="color: #000000;">1</span><span style="color: #0000FF;">)*</span><span style="color: #000000;">50</span><span style="color: #0000FF;">+</span><span style="color: #000000;">1</span><span style="color: #0000FF;">,</span><span style="color: #000000;">s</span><span style="color: #0000FF;">[</span><span style="color: #000000;">i</span><span style="color: #0000FF;">]})</span>
<span style="color: #008080;">end</span> <span style="color: #008080;">for</span>
<span style="color: #7060A8;">printf</span><span style="color: #0000FF;">(</span><span style="color: #000000;">1</span><span style="color: #0000FF;">,</span><span style="color: #008000;">"\nBase counts: A:%d, C:%d, G:%d, T:%d, total:%d\n"</span><span style="color: #0000FF;">,</span><span style="color: #000000;">acgt</span><span style="color: #0000FF;">)</span>
<span style="color: #008080;">end</span> <span style="color: #008080;">procedure</span>
<span style="color: #008080;">procedure</span> <span style="color: #000000;">mutate</span><span style="color: #0000FF;">()</span>
<span style="color: #7060A8;">printf</span><span style="color: #0000FF;">(</span><span style="color: #000000;">1</span><span style="color: #0000FF;">,</span><span style="color: #008000;">"\n"</span><span style="color: #0000FF;">)</span>
<span style="color: #008080;">for</span> <span style="color: #000000;">i</span><span style="color: #0000FF;">=</span><span style="color: #000000;">1</span> <span style="color: #008080;">to</span> <span style="color: #000000;">10</span> <span style="color: #008080;">do</span>
<span style="color: #004080;">integer</span> <span style="color: #000000;">p</span> <span style="color: #0000FF;">=</span> <span style="color: #7060A8;">rand</span><span style="color: #0000FF;">(</span><span style="color: #7060A8;">length</span><span style="color: #0000FF;">(</span><span style="color: #000000;">dna</span><span style="color: #0000FF;">)),</span>
<span style="color: #000000;">sdi</span> <span style="color: #0000FF;">=</span> <span style="color: #008000;">"SDI"</span><span style="color: #0000FF;">[</span><span style="color: #7060A8;">rand</span><span style="color: #0000FF;">(</span><span style="color: #000000;">3</span><span style="color: #0000FF;">)],</span>
<span style="color: #000000;">rep</span> <span style="color: #0000FF;">=</span> <span style="color: #008000;">"ACGT"</span><span style="color: #0000FF;">[</span><span style="color: #7060A8;">rand</span><span style="color: #0000FF;">(</span><span style="color: #000000;">4</span><span style="color: #0000FF;">)],</span>
<span style="color: #000000;">was</span> <span style="color: #0000FF;">=</span> <span style="color: #000000;">dna</span><span style="color: #0000FF;">[</span><span style="color: #000000;">p</span><span style="color: #0000FF;">]</span>
<span style="color: #008080;">switch</span> <span style="color: #000000;">sdi</span> <span style="color: #008080;">do</span>
<span style="color: #008080;">case</span> <span style="color: #008000;">'S'</span><span style="color: #0000FF;">:</span><span style="color: #000000;">dna</span><span style="color: #0000FF;">[</span><span style="color: #000000;">p</span><span style="color: #0000FF;">]</span> <span style="color: #0000FF;">=</span> <span style="color: #000000;">rep</span> <span style="color: #7060A8;">printf</span><span style="color: #0000FF;">(</span><span style="color: #000000;">1</span><span style="color: #0000FF;">,</span><span style="color: #008000;">"swapped %c at %d for %c\n"</span><span style="color: #0000FF;">,{</span><span style="color: #000000;">was</span><span style="color: #0000FF;">,</span><span style="color: #000000;">p</span><span style="color: #0000FF;">,</span><span style="color: #000000;">rep</span><span style="color: #0000FF;">})</span>
<span style="color: #008080;">case</span> <span style="color: #008000;">'D'</span><span style="color: #0000FF;">:</span><span style="color: #000000;">dna</span><span style="color: #0000FF;">[</span><span style="color: #000000;">p</span><span style="color: #0000FF;">..</span><span style="color: #000000;">p</span><span style="color: #0000FF;">]</span> <span style="color: #0000FF;">=</span> <span style="color: #008000;">""</span> <span style="color: #7060A8;">printf</span><span style="color: #0000FF;">(</span><span style="color: #000000;">1</span><span style="color: #0000FF;">,</span><span style="color: #008000;">"deleted %c at %d\n"</span><span style="color: #0000FF;">,{</span><span style="color: #000000;">was</span><span style="color: #0000FF;">,</span><span style="color: #000000;">p</span><span style="color: #0000FF;">})</span>
<span style="color: #008080;">case</span> <span style="color: #008000;">'I'</span><span style="color: #0000FF;">:</span><span style="color: #000000;">dna</span><span style="color: #0000FF;">[</span><span style="color: #000000;">p</span><span style="color: #0000FF;">..</span><span style="color: #000000;">p</span><span style="color: #0000FF;">-</span><span style="color: #000000;">1</span><span style="color: #0000FF;">]</span> <span style="color: #0000FF;">=</span> <span style="color: #008000;">""</span><span style="color: #0000FF;">&</span><span style="color: #000000;">rep</span> <span style="color: #7060A8;">printf</span><span style="color: #0000FF;">(</span><span style="color: #000000;">1</span><span style="color: #0000FF;">,</span><span style="color: #008000;">"inserted %c at %d, before %c\n"</span><span style="color: #0000FF;">,{</span><span style="color: #000000;">rep</span><span style="color: #0000FF;">,</span><span style="color: #000000;">p</span><span style="color: #0000FF;">,</span><span style="color: #000000;">was</span><span style="color: #0000FF;">})</span>
<span style="color: #008080;">end</span> <span style="color: #008080;">switch</span>
<span style="color: #008080;">end</span> <span style="color: #008080;">for</span>
<span style="color: #7060A8;">printf</span><span style="color: #0000FF;">(</span><span style="color: #000000;">1</span><span style="color: #0000FF;">,</span><span style="color: #008000;">"\n"</span><span style="color: #0000FF;">)</span>
<span style="color: #008080;">end</span> <span style="color: #008080;">procedure</span>
<span style="color: #000000;">show</span><span style="color: #0000FF;">()</span>
<span style="color: #000000;">mutate</span><span style="color: #0000FF;">()</span>
<span style="color: #000000;">show</span><span style="color: #0000FF;">()</span>
<!--

View file

@ -0,0 +1,58 @@
#BASE$="ACGT"
#SEQLEN=200
#PROTOCOL=#True
Global dna.s
Define i.i
Procedure pprint()
Define p.i, cnt.i, sum.i
For p=1 To Len(dna) Step 50
Print(RSet(Str(p-1)+": ",5))
PrintN(Mid(dna,p,50))
Next
PrintN("Base counts:")
For p=1 To 4
cnt=CountString(dna,Mid(#BASE$,p,1)) : sum+cnt
Print(Mid(#BASE$,p,1)+": "+Str(cnt)+", ")
Next
PrintN("Total: "+Str(sum))
EndProcedure
Procedure InsertAtPos(basenr.i,position.i)
If #PROTOCOL : PrintN("Insert base "+Mid(#BASE$,basenr,1)+" at position "+Str(position)) : EndIf
dna=InsertString(dna,Mid(#BASE$,basenr,1),position)
EndProcedure
Procedure EraseAtPos(position.i)
If #PROTOCOL : PrintN("Erase base "+Mid(dna,position,1)+" at position "+Str(position)) : EndIf
If position>0 And position<=Len(dna)
dna=Left(dna,position-1)+Right(dna,Len(dna)-position)
EndIf
EndProcedure
Procedure OverwriteAtPos(basenr.i,position.i)
If #PROTOCOL : PrintN("Change base at position "+Str(position)+" from "+Mid(dna,position,1)+" to "+Mid(#BASE$,basenr,1)) : EndIf
If position>0 And position<=Len(dna)
position-1
PokeS(@dna+2*position,Mid(#BASE$,basenr,1),-1,#PB_String_NoZero)
EndIf
EndProcedure
If OpenConsole()=0 : End 1 : EndIf
For i=1 To #SEQLEN : dna+Mid(#BASE$,Random(4,1),1) : Next
PrintN("Initial sequence:")
pprint()
For i=1 To 10
Select Random(2)
Case 0 : InsertAtPos(Random(4,1),Random(Len(dna),1))
Case 1 : EraseAtPos(Random(Len(dna),1))
Case 2 : OverwriteAtPos(Random(4,1),Random(Len(dna),1))
EndSelect
Next
PrintN("After 10 mutations:")
pprint()
Input()

View file

@ -0,0 +1,46 @@
import random
from collections import Counter
def basecount(dna):
return sorted(Counter(dna).items())
def seq_split(dna, n=50):
return [dna[i: i+n] for i in range(0, len(dna), n)]
def seq_pp(dna, n=50):
for i, part in enumerate(seq_split(dna, n)):
print(f"{i*n:>5}: {part}")
print("\n BASECOUNT:")
tot = 0
for base, count in basecount(dna):
print(f" {base:>3}: {count}")
tot += count
base, count = 'TOT', tot
print(f" {base:>3}= {count}")
def seq_mutate(dna, count=1, kinds="IDSSSS", choice="ATCG" ):
mutation = []
k2txt = dict(I='Insert', D='Delete', S='Substitute')
for _ in range(count):
kind = random.choice(kinds)
index = random.randint(0, len(dna))
if kind == 'I': # Insert
dna = dna[:index] + random.choice(choice) + dna[index:]
elif kind == 'D' and dna: # Delete
dna = dna[:index] + dna[index+1:]
elif kind == 'S' and dna: # Substitute
dna = dna[:index] + random.choice(choice) + dna[index+1:]
mutation.append((k2txt[kind], index))
return dna, mutation
if __name__ == '__main__':
length = 250
print("SEQUENCE:")
sequence = ''.join(random.choices('ACGT', weights=(1, 0.8, .9, 1.1), k=length))
seq_pp(sequence)
print("\n\nMUTATIONS:")
mseq, m = seq_mutate(sequence, 10)
for kind, index in m:
print(f" {kind:>10} @{index}")
print()
seq_pp(mseq)

View file

@ -0,0 +1,18 @@
[ $ "ACGT" 4 random peek ] is randomgene ( --> c )
[ $ "" swap times
[ randomgene join ] ] is randomsequence ( n --> $ )
[ dup size random
3 random
[ table
[ pluck drop ]
[ randomgene unrot stuff ]
[ randomgene unrot poke ] ]
do ] is mutate ( $ --> $ )
200 randomsequence
dup prettyprint cr cr dup tallybases
cr cr say "Mutating..." cr
10 times mutate
dup prettyprint cr cr tallybases

View file

@ -0,0 +1,78 @@
#lang racket
(define current-S-weight (make-parameter 1))
(define current-D-weight (make-parameter 1))
(define current-I-weight (make-parameter 1))
(define bases '(#\A #\C #\G #\T))
(define (fold-sequence seq kons #:finalise (finalise (λ x (apply values x))) . k0s)
(define (recur seq . ks)
(if (null? seq)
(call-with-values (λ () (apply finalise ks)) (λ vs (apply values vs)))
(call-with-values (λ () (apply kons (car seq) ks)) (λ ks+ (apply recur (cdr seq) ks+)))))
(apply recur (if (string? seq) (string->list (regexp-replace* #px"[^ACGT]" seq "")) seq) k0s))
(define (sequence->pretty-printed-string seq)
(define (fmt idx cs-rev) (format "~a: ~a" (~a idx #:width 3 #:align 'right) (list->string (reverse cs-rev))))
(fold-sequence
seq
(λ (b n start-idx lns-rev cs-rev)
(if (zero? (modulo n 50))
(values (+ n 1) n (if (pair? cs-rev) (cons (fmt start-idx cs-rev) lns-rev) lns-rev) (cons b null))
(values (+ n 1) start-idx lns-rev (cons b cs-rev))))
0 0 null null
#:finalise (λ (n idx lns-rev cs-rev)
(string-join (reverse (if (null? cs-rev) lns-rev (cons (fmt idx cs-rev) lns-rev))) "\n"))))
(define (count-bases b as cs gs ts n)
(values (+ as (if (eq? b #\A) 1 0)) (+ cs (if (eq? b #\C) 1 0)) (+ gs (if (eq? b #\T) 1 0)) (+ ts (if (eq? b #\G) 1 0)) (add1 n)))
(define (report-sequence s)
(define-values (as cs gs ts n) (fold-sequence s count-bases 0 0 0 0 0))
(printf "SEQUENCE:~%~a~%" (sequence->pretty-printed-string s))
(printf "BASE COUNT:~%-----------~%~a~%"
(string-join (map (λ (c n) (format " ~a :~a" c (~a #:width 4 #:align 'right n))) bases (list as ts cs gs)) "\n"))
(printf "TOTAL: ~a~%" n))
(define (make-random-sequence-string l)
(list->string (for/list ((_ l)) (list-ref bases (random 4)))))
(define (weighted-random-call weights-and-functions . args)
(let loop ((r (random)) (wfs weights-and-functions))
(if (<= r (car wfs)) (apply (cadr wfs) args) (loop (- r (car wfs)) (cddr wfs)))))
(define (mutate-S s)
(let ((r (random (string-length s))) (i (string (list-ref bases (random 4)))))
(printf "Mutate at ~a -> ~a~%" r i)
(string-append (substring s 0 r) i (substring s (add1 r)))))
(define (mutate-D s)
(let ((r (random (string-length s))))
(printf "Delete at ~a~%" r)
(string-append (substring s 0 r) (substring s (add1 r)))))
(define (mutate-I s)
(let ((r (random (string-length s))) (i (string (list-ref bases (random 4)))))
(printf "Insert at ~a -> ~a~%" r i)
(string-append (substring s 0 r) i (substring s r))))
(define (mutate s)
(define W (+ (current-S-weight) (current-D-weight) (current-I-weight)))
(weighted-random-call
(list (/ (current-S-weight) W) mutate-S (/ (current-D-weight) W) mutate-D (/ (current-I-weight) W) mutate-I)
s))
(module+
main
(define initial-sequence (make-random-sequence-string 200))
(report-sequence initial-sequence)
(newline)
(define s+ (for/fold ((s initial-sequence)) ((_ 10)) (mutate s)))
(newline)
(report-sequence s+)
(newline)
(define s+d (parameterize ((current-D-weight 5)) (for/fold ((s initial-sequence)) ((_ 10)) (mutate s))))
(newline)
(report-sequence s+d))

View file

@ -0,0 +1,32 @@
my @bases = <A C G T>;
# The DNA strand
my $dna = @bases.roll(200).join;
# The Task
put "ORIGINAL DNA STRAND:";
put pretty $dna;
put "\nTotal bases: ", +my $bases = $dna.comb.Bag;
put $bases.sort( ~*.key ).join: "\n";
put "\nMUTATED DNA STRAND:";
my $mutate = $dna.&mutate(10);
put pretty diff $dna, $mutate;
put "\nTotal bases: ", +my $mutated = $mutate.comb.Bag;
put $mutated.sort( ~*.key ).join: "\n";
# Helper subs
sub pretty ($string, $wrap = 50) {
$string.comb($wrap).map( { sprintf "%8d: %s", $++ * $wrap, $_ } ).join: "\n"
}
sub mutate ($dna is copy, $count = 1) {
$dna.substr-rw((^$dna.chars).roll, 1) = @bases.roll for ^$count;
$dna
}
sub diff ($orig, $repl) {
($orig.comb Z $repl.comb).map( -> ($o, $r) { $o eq $r ?? $o !! $r.lc }).join
}

View file

@ -0,0 +1,112 @@
row = 0
dnaList = []
base = ["A","C","G","T"]
long = 20
see "Initial sequence:" + nl
see " 12345678901234567890" + nl
see " " + long + ": "
for nr = 1 to 200
row = row + 1
rnd = random(3)+1
baseStr = base[rnd]
see baseStr # + " "
if (row%20) = 0 and long < 200
long = long + 20
see nl
if long < 100
see " " + long + ": "
else
see "" + long + ": "
ok
ok
add(dnaList,baseStr)
next
see nl+ " 12345678901234567890" + nl
baseCount(dnaList)
for n = 1 to 10
rnd = random(2)+1
switch rnd
on 1
baseSwap(dnaList)
on 2
baseDelete(dnaList)
on 3
baseInsert(dnaList)
off
next
showDna(dnaList)
baseCount(dnaList)
func baseInsert(dnaList)
rnd1 = random(len(dnaList)-1)+1
rnd2 = random(len(base)-1)+1
insert(dnaList,rnd1,base[rnd2])
see "Insert base " + base[rnd2] + " at position " + rnd1 + nl
return dnaList
func baseDelete(dnaList)
rnd = random(len(dnaList)-1)+1
del(dnaList,rnd)
see "Erase base " + dnaList[rnd] + " at position " + rnd + nl
return dnaList
func baseSwap(dnaList)
rnd1 = random(len(dnaList))
rnd2 = random(3)+1
see "Change base at position " + rnd1 + " from " + dnaList[rnd1] + " to " + base[rnd2] + nl
dnaList[rnd1] = base[rnd2]
func showDna(dnaList)
long = 20
see nl + "After 10 mutations:" + nl
see " 12345678901234567890" + nl
see " " + long + ": "
for nr = 1 to len(dnaList)
row = row + 1
see dnaList[nr]
if (row%20) = 0 and long < 200
long = long + 20
see nl
if long < 100
see " " + long + ": "
else
see "" + long + ": "
ok
ok
next
see nl+ " 12345678901234567890" + nl
func baseCount(dnaList)
dnaBase = [:A=0, :C=0, :G=0, :T=0]
lenDna = len(dnaList)
for n = 1 to lenDna
dnaStr = dnaList[n]
switch dnaStr
on "A"
strA = dnaBase["A"]
strA++
dnaBase["A"] = strA
on "C"
strC = dnaBase["C"]
strC++
dnaBase["C"] = strC
on "G"
strG = dnaBase["G"]
strG++
dnaBase["G"] = strG
on "T"
strT = dnaBase["T"]
strT++
dnaBase["T"] = strT
off
next
see nl
see "A: " + dnaBase["A"] + ", "
see "T: " + dnaBase["T"] + ", "
see "C: " + dnaBase["C"] + ", "
see "G: " + dnaBase["G"] + ", "
total = dnaBase["A"] + dnaBase["T"] + dnaBase["C"] + dnaBase["G"]
see "Total: " + total+ nl + nl

View file

@ -0,0 +1,34 @@
class DNA_Seq
attr_accessor :seq
def initialize(bases: %i[A C G T] , size: 0)
@bases = bases
@seq = Array.new(size){ bases.sample }
end
def mutate(n = 10)
n.times{|n| method([:s, :d, :i].sample).call}
end
def to_s(n = 50)
just_size = @seq.size / n
(0...@seq.size).step(n).map{|from| "#{from.to_s.rjust(just_size)} " + @seq[from, n].join}.join("\n") +
"\nTotal #{seq.size}: #{@seq.tally.sort.to_h.inspect}\n\n"
end
def s = @seq[rand_index]= @bases.sample
def d = @seq.delete_at(rand_index)
def i = @seq.insert(rand_index, @bases.sample )
alias :swap :s
alias :delete :d
alias :insert :i
private
def rand_index = rand( @seq.size )
end
puts test = DNA_Seq.new(size: 200)
test.mutate
puts test
test.delete
puts test

View file

@ -0,0 +1,96 @@
use rand::prelude::*;
use std::collections::HashMap;
use std::fmt::{Display, Formatter, Error};
pub struct Seq<'a> {
alphabet: Vec<&'a str>,
distr: rand::distributions::Uniform<usize>,
pos_distr: rand::distributions::Uniform<usize>,
seq: Vec<&'a str>,
}
impl Display for Seq<'_> {
fn fmt(&self, f: &mut Formatter) -> Result<(), Error> {
let pretty: String = self.seq
.iter()
.enumerate()
.map(|(i, nt)| if (i + 1) % 60 == 0 { format!("{}\n", nt) } else { nt.to_string() })
.collect();
let counts_hm = self.seq
.iter()
.fold(HashMap::<&str, usize>::new(), |mut m, nt| {
*m.entry(nt).or_default() += 1;
m
});
let mut counts_vec: Vec<(&str, usize)> = counts_hm.into_iter().collect();
counts_vec.sort_by(|a, b| a.0.cmp(&b.0));
let counts_string = counts_vec
.iter()
.fold(String::new(), |mut counts_string, (nt, count)| {
counts_string += &format!("{} = {}\n", nt, count);
counts_string
});
write!(f, "Seq:\n{}\n\nLength: {}\n\nCounts:\n{}", pretty, self.seq.len(), counts_string)
}
}
impl Seq<'_> {
pub fn new(alphabet: Vec<&str>, len: usize) -> Seq {
let distr = rand::distributions::Uniform::new_inclusive(0, alphabet.len() - 1);
let pos_distr = rand::distributions::Uniform::new_inclusive(0, len - 1);
let seq: Vec<&str> = (0..len)
.map(|_| {
alphabet[thread_rng().sample(distr)]
})
.collect();
Seq { alphabet, distr, pos_distr, seq }
}
pub fn insert(&mut self) {
let pos = thread_rng().sample(self.pos_distr);
let nt = self.alphabet[thread_rng().sample(self.distr)];
println!("Inserting {} at position {}", nt, pos);
self.seq.insert(pos, nt);
}
pub fn delete(&mut self) {
let pos = thread_rng().sample(self.pos_distr);
println!("Deleting {} at position {}", self.seq[pos], pos);
self.seq.remove(pos);
}
pub fn swap(&mut self) {
let pos = thread_rng().sample(self.pos_distr);
let cur_nt = self.seq[pos];
let new_nt = self.alphabet[thread_rng().sample(self.distr)];
println!("Replacing {} at position {} with {}", cur_nt, pos, new_nt);
self.seq[pos] = new_nt;
}
}
fn main() {
let mut seq = Seq::new(vec!["A", "C", "T", "G"], 200);
println!("Initial sequnce:\n{}", seq);
let mut_distr = rand::distributions::Uniform::new_inclusive(0, 2);
for _ in 0..10 {
let mutation = thread_rng().sample(mut_distr);
if mutation == 0 {
seq.insert()
} else if mutation == 1 {
seq.delete()
} else {
seq.swap()
}
}
println!("\nMutated sequence:\n{}", seq);
}

View file

@ -0,0 +1,57 @@
let bases: [Character] = ["A", "C", "G", "T"]
enum Action: CaseIterable {
case swap, delete, insert
}
@discardableResult
func mutate(dna: inout String) -> Action {
guard let i = dna.indices.shuffled().first(where: { $0 != dna.endIndex }) else {
fatalError()
}
let action = Action.allCases.randomElement()!
switch action {
case .swap:
dna.replaceSubrange(i..<i, with: [bases.randomElement()!])
case .delete:
dna.remove(at: i)
case .insert:
dna.insert(bases.randomElement()!, at: i)
}
return action
}
var d = ""
for _ in 0..<200 {
d.append(bases.randomElement()!)
}
func printSeq(_ dna: String) {
for startI in stride(from: 0, to: dna.count, by: 50) {
print("\(startI): \(dna.dropFirst(startI).prefix(50))")
}
print()
print("Size: \(dna.count)")
print()
let counts = dna.reduce(into: [:], { $0[$1, default: 0] += 1 })
for (char, count) in counts.sorted(by: { $0.key < $1.key }) {
print("\(char): \(count)")
}
}
printSeq(d)
print()
for _ in 0..<20 {
mutate(dna: &d)
}
printSeq(d)

View file

@ -0,0 +1,93 @@
import rand
import rand.seed
const bases = "ACGT"
// 'w' contains the weights out of 300 for each
// of swap, delete or insert in that order.
fn mutate(dna string, w [3]int) string {
le := dna.len
// get a random position in the dna to mutate
p := rand.intn(le) or {0}
// get a random number between 0 and 299 inclusive
r := rand.intn(300) or {0}
mut bytes := dna.bytes()
match true {
r < w[0] { // swap
base := bases[rand.intn(4) or {0}]
println(" Change @${p:3} ${[bytes[p]].bytestr()} to ${[base].bytestr()}")
bytes[p] = base
}
r < w[0]+w[1] { // delete
println(" Delete @${p:3} ${bytes[p]}")
bytes.delete(p)
//copy(bytes[p:], bytes[p+1:])
bytes = bytes[0..le-1]
}
else { // insert
base := bases[rand.intn(4) or {0}]
bytes << 0
bytes.insert(p,bytes[p])
//copy(bytes[p+1:], bytes[p:])
println(" Insert @${p:3} $base")
bytes[p] = base
}
}
return bytes.bytestr()
}
// Generate a random dna sequence of given length.
fn generate(le int) string {
mut bytes := []u8{len:le}
for i := 0; i < le; i++ {
bytes[i] = bases[rand.intn(4) or {0}]
}
return bytes.bytestr()
}
// Pretty print dna and stats.
fn pretty_print(dna string, rowLen int) {
println("SEQUENCE:")
le := dna.len
for i := 0; i < le; i += rowLen {
mut k := i + rowLen
if k > le {
k = le
}
println("${i:5}: ${dna[i..k]}")
}
mut base_map := map[byte]int{} // allows for 'any' base
for i in 0..le {
base_map[dna[i]]++
}
mut bb := base_map.keys()
bb.sort()
println("\nBASE COUNT:")
for base in bb {
println(" $base: ${base_map[base]:3}")
}
println(" ------")
println(" Σ: $le")
println(" ======\n")
}
// Express weights as a string.
fn wstring(w [3]int) string {
return " Change: ${w[0]}\n Delete: ${w[1]}\n Insert: ${w[2]}\n"
}
fn main() {
rand.seed(seed.time_seed_array(2))
mut dna := generate(250)
pretty_print(dna, 50)
muts := 10
w := [100, 100, 100]! // use e.g. {0, 300, 0} to choose only deletions
println("WEIGHTS (ex 300):\n${wstring(w)}")
println("MUTATIONS ($muts):")
for _ in 0..muts {
dna = mutate(dna, w)
}
println('')
pretty_print(dna, 50)
}

View file

@ -0,0 +1,78 @@
import "random" for Random
import "/fmt" for Fmt
import "/sort" for Sort
var rand = Random.new()
var bases = "ACGT"
// 'w' contains the weights out of 300 for each
// of swap, delete or insert in that order.
var mutate = Fn.new { |dna, w|
var le = dna.count
// get a random position in the dna to mutate
var p = rand.int(le)
// get a random number between 0 and 299 inclusive
var r = rand.int(300)
var chars = dna.toList
if (r < w[0]) { // swap
var base = bases[rand.int(4)]
Fmt.print(" Change @$3d $q to $q", p, chars[p], base)
chars[p] = base
} else if (r < w[0] + w[1]) { // delete
Fmt.print(" Delete @$3d $q", p, chars[p])
chars.removeAt(p)
} else { // insert
var base = bases[rand.int(4)]
Fmt.print(" Insert @$3d $q", p, base)
chars.insert(p, base)
}
return chars.join()
}
// Generate a random dna sequence of given length.
var generate = Fn.new { |le|
var chars = [""] * le
for (i in 0...le) chars[i] = bases[rand.int(4)]
return chars.join()
}
// Pretty print dna and stats.
var prettyPrint = Fn.new { |dna, rowLen|
System.print("SEQUENCE:")
var le = dna.count
var i = 0
while (i < le) {
var k = i + rowLen
if (k > le) k = le
Fmt.print("$5d: $s", i, dna[i...k])
i = i + rowLen
}
var baseMap = {}
for (i in 0...le) {
var v = baseMap[dna[i]]
baseMap[dna[i]] = (v) ? v + 1 : 1
}
var bases = []
for (k in baseMap.keys) bases.add(k)
Sort.insertion(bases) // get bases into alphabetic order
System.print("\nBASE COUNT:")
for (base in bases) Fmt.print(" $s: $3d", base, baseMap[base])
System.print(" ------")
System.print(" Σ: %(le)")
System.print(" ======\n")
}
// Express weights as a string.
var wstring = Fn.new { |w|
return Fmt.swrite(" Change: $d\n Delete: $d\n Insert: $d\n", w[0], w[1], w[2])
}
var dna = generate.call(250)
prettyPrint.call(dna, 50)
var muts = 10
var w = [100, 100, 100] // use e.g. {0, 300, 0} to choose only deletions
Fmt.print("WEIGHTS (ex 300):\n$s", wstring.call(w))
Fmt.print("MUTATIONS ($d):", muts)
for (i in 0...muts) dna = mutate.call(dna, w)
System.print()
prettyPrint.call(dna, 50)

View file

@ -0,0 +1,53 @@
// Rosetta Code problem: http://rosettacode.org/wiki/Sequence_mutation
// by Galileo, 07/2022
r = int(ran(300))
for i = 1 to 200 + r : dna$ = dna$ + mid$("ACGT", int(ran(4))+1, 1) : next
sub show()
local acgt(4), i, j, x, total
for i = 1 to len(dna$)
x = instr("ACGT", mid$(dna$, i, 1))
acgt(x) = acgt(x) + 1
next
for i = 1 to 4 : total = total + acgt(i) : next
for i = 1 to len(dna$) step 50
print i, ":\t";
for j = 0 to 49 step 10
print mid$(dna$, i+j, 10), " ";
next
print
next
print "\nBase counts: A: ", acgt(1), ", C: ", acgt(2), ", G: ", acgt(3), ", T: ", acgt(4), ", total: ", total
end sub
sub mutate()
local i, p, sdi$, rep$, was$
print
for i = 1 to 10
p = int(ran(len(dna$))) + 1
sdi$ = mid$("SDI", int(ran(3)) + 1, 1)
rep$ = mid$("ACGT", int(ran(4)) + 1, 1)
was$ = mid$(dna$, p, 1)
switch sdi$
case "S": mid$(dna$, p, 1) = rep$
print "swapped ", was$, " at ", p, " for ", rep$ : break
case "D": dna$ = left$(dna$, p - 1) + right$(dna$, len(dna$) - p)
print "deleted ", was$, " at ", p : break
case "I": dna$ = left$(dna$, p - 1) + rep$ + right$(dna$, (len(dna$) - p + 1))
print "inserted ", rep$, " at ", p, ", before ", was$ : break
end switch
next
print
end sub
show()
mutate()
show()

View file

@ -0,0 +1,33 @@
var [const] bases="ACGT", lbases=bases.toLower();
dna:=(190).pump(Data().howza(3),(0).random.fp(0,4),bases.get); // bucket of bytes
foreach s,m in (T("Original","Mutated").zip(T(True,False))){
println("\n",s," DNA strand:"); dnaPP(dna);
println("Base Counts: ", dna.len()," : ",
dna.text.toUpper().counts() // ("A",5, "C",10, ...)
.pump(String,Void.Read,"%s(%d) ".fmt));
if(m) mutate(dna,10,True);
}
fcn mutate(dna,count=1,verbose=False){
if(verbose) println("Mutating:");
do(count){
n,rb := (0).random(dna.len()), lbases[(0).random(4)];
switch( (0).random(3) ){
case(0){ if(verbose) println("Change[%d] '%s' to '%s'".fmt(n,dna.charAt(n),rb));
dna[n]=rb;
}
case(1){ if(verbose) println("Delete[%d] '%s'".fmt(n,dna.charAt(n)));
dna.del(n);
}
else{ if(verbose) println("Insert[%d] '%s'".fmt(n,rb));
dna.insert(n,rb);
}
}
}
}
fcn dnaPP(dna,N=50){
[0..*,50].zipWith(fcn(n,bases){ println("%6d: %s".fmt(n,bases.concat())) },
dna.walker().walk.fp(50)).pump(Void); // .pump forces the iterator
}