Initial data commit

Task/Bioinformatics-base-count/Java/bioinformatics-base-count-1.java

@@ -0,0 +1,39 @@
+void printBaseCount(String string) throws IOException {
+    BufferedReader reader = new BufferedReader(new StringReader(string));
+    int index = 0;
+    String sequence;
+    int A = 0, C = 0, G = 0, T = 0;
+    int a, c, g, t;
+    while ((sequence = reader.readLine()) != null) {
+        System.out.printf("%d %s ", index++, sequence);
+        a = c = g = t = 0;
+        for (char base : sequence.toCharArray()) {
+            switch (base) {
+                case 'A' -> {
+                    A++;
+                    a++;
+                }
+                case 'C' -> {
+                    C++;
+                    c++;
+                }
+                case 'G' -> {
+                    G++;
+                    g++;
+                }
+                case 'T' -> {
+                    T++;
+                    t++;
+                }
+            }
+        }
+        System.out.printf("[A %2d, C %2d, G %2d, T %2d]%n", a, c, g, t);
+    }
+    reader.close();
+    int total = A + C + G + T;
+    System.out.printf("%nTotal of %d bases%n", total);
+    System.out.printf("A %3d (%.2f%%)%n", A, ((double) A / total) * 100);
+    System.out.printf("C %3d (%.2f%%)%n", C, ((double) C / total) * 100);
+    System.out.printf("G %3d (%.2f%%)%n", G, ((double) G / total) * 100);
+    System.out.printf("T %3d (%.2f%%)%n", T, ((double) T / total) * 100);
+}

Task/Bioinformatics-base-count/Java/bioinformatics-base-count-2.java

@@ -0,0 +1,47 @@
+import java.util.HashMap;
+import java.util.Map;
+
+public class orderedSequence {
+    public static void main(String[] args) {
+        Sequence gene = new Sequence("CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATATTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTATCGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTGTCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGACGACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT");
+        gene.runSequence();
+    }
+}
+
+/** Separate class for defining behaviors */
+public class Sequence {
+
+    private final String seq;
+
+    public Sequence(String sq) {
+        this.seq = sq;
+    }
+
+    /** print the organized structure of the sequence */
+    public void prettyPrint() {
+        System.out.println("Sequence:");
+        int i = 0;
+        for ( ; i < seq.length() - 50 ; i += 50) {
+            System.out.printf("%5s : %s\n", i + 50, seq.substring(i, i + 50));
+        }
+        System.out.printf("%5s : %s\n", seq.length(), seq.substring(i));
+    }
+
+    /** display a base vs. frequency chart */
+    public void displayCount() {
+        Map<Character, Integer> counter = new HashMap<>();
+        for (int i = 0 ; i < seq.length() ; ++i) {
+            counter.merge(seq.charAt(i), 1, Integer::sum);
+        }
+
+        System.out.println("Base vs. Count:");
+        counter.forEach(
+            key, value -> System.out.printf("%5s : %s\n", key, value));
+        System.out.printf("%5s: %s\n", "SUM", seq.length());
+    }
+
+    public void runSequence() {
+        this.prettyPrint();
+        this.displayCount();
+    }
+}