Initial data commit

Task/Bioinformatics-base-count/JavaScript/bioinformatics-base-count.js

@@ -0,0 +1,67 @@
+const rowLength = 50;
+
+const bases = ['A', 'C', 'G', 'T'];
+
+// Create the starting sequence
+const seq = `CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG
+CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG
+AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT
+GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT
+CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG
+TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA
+TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT
+CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG
+TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC
+GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT`
+    .split('')
+    .filter(e => bases.includes(e))
+
+/**
+ * Convert the given array into an array of smaller arrays each with the length
+ * given by n.
+ * @param {number} n
+ * @returns {function(!Array<*>): !Array<!Array<*>>}
+ */
+const chunk = n => a => a.reduce(
+    (p, c, i) => (!(i % n)) ? p.push([c]) && p : p[p.length - 1].push(c) && p,
+    []);
+const toRows = chunk(rowLength);
+
+/**
+ * Given a number, return function that takes a string and left pads it to n
+ * @param {number} n
+ * @returns {function(string): string}
+ */
+const padTo = n => v => ('' + v).padStart(n, ' ');
+const pad = padTo(5);
+
+/**
+ * Count the number of elements that match the given value in an array
+ * @param {Array<string>} arr
+ * @returns {function(string): number}
+ */
+const countIn = arr => s => arr.filter(e => e === s).length;
+
+/**
+ * Utility logging function
+ * @param {string|number} v
+ * @param {string|number} n
+ */
+const print = (v, n) => console.log(`${pad(v)}:\t${n}`)
+
+const prettyPrint = seq => {
+  const chunks = toRows(seq);
+  console.log('SEQUENCE:')
+  chunks.forEach((e, i) => print(i * rowLength, e.join('')))
+}
+
+const printBases = (seq, bases) => {
+  const filterSeq = countIn(seq);
+  const counts = bases.map(filterSeq);
+  console.log('\nBASE COUNTS:')
+  counts.forEach((e, i) => print(bases[i], e));
+  print('Total', counts.reduce((p,c) => p + c, 0));
+}
+
+prettyPrint(seq);
+printBases(seq, bases);