aparler/RosettaCodeData
1
0
Fork 0
Code Issues 12 Pull requests 3 Projects Releases Packages Wiki Activity Actions

Initial data commit

Browse source
This commit is contained in:
Ingy döt Net 2023-07-01 11:58:00 -04:00
parent 72d218235f
commit f23f22d71c
199087 changed files with 3378941 additions and 0 deletions
Download patch file Download diff file Expand all files Collapse all files

31
Task/Bioinformatics-base-count/REXX/bioinformatics-base-count.rexx Normal file
View file

@ -0,0 +1,31 @@
/*REXX program finds the number of each base in a DNA string (along with a total). */
parse arg dna .
if dna=='' | dna=="," then dna= 'cgtaaaaaattacaacgtcctttggctatctcttaaactcctgctaaatg' ,
'ctcgtgctttccaattatgtaagcgttccgagacggggtggtcgattctg' ,
'aggacaaaggtcaagatggagcgcatcgaacgcaataaggatcatttgat' ,
'gggacgtttcgtcgacaaagtcttgtttcgagagtaacggctaccgtctt' ,
'cgattctgcttataacactatgttcttatgaaatggatgttctgagttgg' ,
'tcagtcccaatgtgcggggtttcttttagtacgtcgggagtggtattata' ,
'tttaatttttctatatagcgatctgtatttaagcaattcatttaggttat' ,
'cgccgcgatgctcggttcggaccgccaagcatctggctccactgctagtg' ,
'tcctaaatttgaatggcaaacacaaataagatttagcaattcgtgtagac' ,
'gaccggggacttgcatgatgggagcagctttgttaaactacgaacgtaat'
dna= space(dna, 0); upper dna /*elide blanks from DNA; uppercase it. */
say '────────length of the DNA string: ' length(dna)
@.= 0 /*initialize the count for all bases. */
w= 1 /*the maximum width of a base count. */
$= /*a placeholder for the names of bases.*/
do j=1 for length(dna) /*traipse through the DNA string. */
_= substr(dna, j, 1) /*obtain a base name from the DNA str. */
if pos(_, $)==0 then $= $ || _ /*if not found before, add it to list. */
@._= @._ + 1 /*bump the count of this base. */
w= max(w, length(@._) ) /*compute the maximum width number. */
end /*j*/
say
do k=0 for 255; z= d2c(k) /*traipse through all possibilities. */
if pos(z, $)==0 then iterate /*Was this base found? No, then skip. */
say ' base ' z " has a basecount of: " right(@.z, w)
@.tot= @.tot + @.z /*add to a grand total to verify count.*/
end /*k*/ /*stick a fork in it, we're all done. */
say
say '────────total for all basecounts:' right(@.tot, w+1)